Incidental Mutation 'R7260:Utp20'
ID564557
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7260 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88751472 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2487 (I2487T)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: I2487T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: I2487T

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,973,886 S293P probably benign Het
Actn2 T C 13: 12,276,490 N676S probably benign Het
Amfr C T 8: 93,976,148 M463I possibly damaging Het
Ankdd1a G T 9: 65,504,552 A325D probably damaging Het
Apba2 A G 7: 64,739,745 D463G probably damaging Het
Arid5b A G 10: 68,097,807 V755A probably damaging Het
Boc A T 16: 44,490,170 F796I Het
Ccnt1 G A 15: 98,565,124 Q56* probably null Het
Cd248 T A 19: 5,069,355 Y410* probably null Het
Chd9 T A 8: 90,994,543 N986K unknown Het
Col6a6 T C 9: 105,783,969 T314A probably benign Het
Cpped1 A G 16: 11,828,463 F142L possibly damaging Het
Csmd1 C T 8: 16,000,574 A2221T probably damaging Het
Cyp2c69 C A 19: 39,842,900 V490L probably benign Het
Dcst2 T C 3: 89,366,286 F157S probably damaging Het
Ddx54 G T 5: 120,626,920 R788L probably benign Het
Dnah1 T C 14: 31,269,386 Y3145C probably damaging Het
Dnah14 A T 1: 181,706,744 R2320W probably damaging Het
E130309D02Rik A G 5: 143,311,839 V151A probably benign Het
Emilin2 T C 17: 71,274,790 T314A probably benign Het
Eml2 A G 7: 19,200,590 S405G probably benign Het
Ephb2 A G 4: 136,771,574 F65L probably damaging Het
Fam49b A T 15: 63,957,589 F23L possibly damaging Het
Fbn2 T C 18: 58,066,116 D1360G probably benign Het
Fbxo22 A G 9: 55,218,470 T206A probably benign Het
Filip1l A G 16: 57,570,924 E625G probably damaging Het
Gen1 A C 12: 11,256,848 M172R probably damaging Het
Gk5 A G 9: 96,119,610 K54E probably benign Het
Glis3 T C 19: 28,531,402 E394G probably benign Het
Gm16486 T C 8: 70,708,748 Y197H probably benign Het
Helq T A 5: 100,791,927 E373D probably damaging Het
Ighv1-74 A G 12: 115,802,752 F83L probably benign Het
Kdm4d T C 9: 14,463,158 D468G probably benign Het
Kif20b A G 19: 34,950,210 I957M probably damaging Het
Ldhal6b A G 17: 5,418,260 F133S possibly damaging Het
Loxhd1 T C 18: 77,332,642 Y321H possibly damaging Het
Ltbp1 A T 17: 75,066,144 M261L probably benign Het
Mical2 A T 7: 112,319,794 Q430L probably benign Het
Mroh4 A T 15: 74,608,129 N885K possibly damaging Het
Ms4a7 A G 19: 11,322,346 Y231H probably damaging Het
Msh2 G T 17: 87,717,619 V642F probably damaging Het
Muc5b G T 7: 141,842,648 A166S unknown Het
Myo18b T C 5: 112,775,288 I1868V probably benign Het
Nfatc3 T C 8: 106,108,946 S975P probably benign Het
Oacyl T C 18: 65,698,367 L25P probably damaging Het
Olfr1145 A G 2: 87,810,387 N189S probably damaging Het
Olfr1463 T C 19: 13,235,024 F258S probably damaging Het
Olfr151 T A 9: 37,730,753 I77F probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Patj A G 4: 98,416,733 I275V possibly damaging Het
Pdcd11 G A 19: 47,129,234 R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phkb T A 8: 85,878,130 Y55N probably benign Het
Pias4 A G 10: 81,157,468 V207A possibly damaging Het
Plxna4 C A 6: 32,239,520 R540L possibly damaging Het
Psapl1 G A 5: 36,205,212 V383M probably benign Het
Rars C A 11: 35,834,454 A10S probably benign Het
Rhobtb1 A T 10: 69,270,780 K454* probably null Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rngtt T C 4: 33,356,176 S338P possibly damaging Het
Sh3bgr A G 16: 96,224,481 E189G unknown Het
Slc30a3 G A 5: 31,088,346 T281I probably damaging Het
Smok3c T A 5: 138,065,623 D457E possibly damaging Het
Stard9 C A 2: 120,706,938 Q4274K possibly damaging Het
Syne2 G T 12: 75,945,079 L1938F probably damaging Het
Tmem70 C A 1: 16,665,366 T20K possibly damaging Het
Tnrc6a A G 7: 123,186,590 E1502G probably benign Het
Tpp1 A T 7: 105,747,497 S438T probably benign Het
Tubb2a T A 13: 34,075,414 Q131L probably damaging Het
Ube2v1 A G 2: 167,629,194 S26P probably benign Het
Unc13a G T 8: 71,660,585 S207R possibly damaging Het
Usp35 T G 7: 97,320,079 D362A probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r117 T A 17: 23,475,385 H496L probably benign Het
Vmn2r92 C T 17: 18,166,876 A159V probably damaging Het
Wdr63 T A 3: 146,046,540 M794L probably benign Het
Wiz T C 17: 32,359,111 K467E probably damaging Het
Zfp534 T C 4: 147,675,004 T403A probably benign Het
Zswim5 T C 4: 116,962,646 L416P probably damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTCAGCTTGATTTTAGGCTAGCTAG -3'
(R):5'- TTCATAGGGAACGGTGGGAC -3'

Sequencing Primer
(F):5'- TGTTAGGAACCTGACTGC -3'
(R):5'- AAGCAGGGACCGTCATTTTC -3'
Posted On2019-06-26