Incidental Mutation 'R7261:Zbtb26'
ID564598
Institutional Source Beutler Lab
Gene Symbol Zbtb26
Ensembl Gene ENSMUSG00000050714
Gene Namezinc finger and BTB domain containing 26
SynonymsA630026F21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37432168-37443135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37436655 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 123 (M123K)
Ref Sequence ENSEMBL: ENSMUSP00000099850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067043] [ENSMUST00000102789] [ENSMUST00000112932]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067043
AA Change: M112K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070071
Gene: ENSMUSG00000050714
AA Change: M112K

DomainStartEndE-ValueType
BTB 33 127 4.38e-12 SMART
low complexity region 169 179 N/A INTRINSIC
ZnF_C2H2 273 295 1.36e-2 SMART
ZnF_C2H2 298 320 1.4e-4 SMART
ZnF_C2H2 326 348 2.99e-4 SMART
ZnF_C2H2 354 377 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102789
AA Change: M123K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099850
Gene: ENSMUSG00000050714
AA Change: M123K

DomainStartEndE-ValueType
BTB 44 138 4.38e-12 SMART
low complexity region 180 190 N/A INTRINSIC
ZnF_C2H2 284 306 1.36e-2 SMART
ZnF_C2H2 309 331 1.4e-4 SMART
ZnF_C2H2 337 359 2.99e-4 SMART
ZnF_C2H2 365 388 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112932
SMART Domains Protein: ENSMUSP00000108554
Gene: ENSMUSG00000066798

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Zbtb26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Zbtb26 APN 2 37436442 missense possibly damaging 0.82
IGL00899:Zbtb26 APN 2 37436258 nonsense probably null
IGL01598:Zbtb26 APN 2 37436271 missense probably damaging 1.00
IGL01940:Zbtb26 APN 2 37435975 missense possibly damaging 0.93
IGL02152:Zbtb26 APN 2 37436691 missense possibly damaging 0.95
IGL02867:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL02889:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL03081:Zbtb26 APN 2 37436600 missense possibly damaging 0.67
R0138:Zbtb26 UTSW 2 37436041 missense probably benign 0.16
R0328:Zbtb26 UTSW 2 37436795 missense possibly damaging 0.81
R0927:Zbtb26 UTSW 2 37436325 missense possibly damaging 0.91
R1671:Zbtb26 UTSW 2 37436365 missense probably benign 0.00
R1813:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R1896:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R2128:Zbtb26 UTSW 2 37436551 missense probably benign 0.00
R2374:Zbtb26 UTSW 2 37436485 missense probably benign
R4050:Zbtb26 UTSW 2 37436988 start codon destroyed probably null 0.46
R4631:Zbtb26 UTSW 2 37436956 missense probably benign 0.00
R4940:Zbtb26 UTSW 2 37436769 missense probably damaging 0.98
R5071:Zbtb26 UTSW 2 37435929 missense probably benign 0.26
R6348:Zbtb26 UTSW 2 37435675 missense probably benign 0.43
R6962:Zbtb26 UTSW 2 37436094 missense possibly damaging 0.71
R6990:Zbtb26 UTSW 2 37436545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCATACTGTCTTCAGATGGATG -3'
(R):5'- CTCATAGATGATGTTGAGGTGCAG -3'

Sequencing Primer
(F):5'- CTGTCTTCAGATGGATGAATACAAGG -3'
(R):5'- AAAATTGTTTTTGCTGCAGGTTCCC -3'
Posted On2019-06-26