Incidental Mutation 'R7261:Lnx1'
ID564608
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Nameligand of numb-protein X 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7261 (G1)
Quality Score168.009
Status Not validated
Chromosome5
Chromosomal Location74592447-74702912 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 74677514 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 29 (S29*)
Ref Sequence ENSEMBL: ENSMUSP00000040098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000117388] [ENSMUST00000117525] [ENSMUST00000121690] [ENSMUST00000127396] [ENSMUST00000153543]
PDB Structure
Crystal Structure Analysis of the PDZ Domain Derived from the Tight Junction Regulating Protein [X-RAY DIFFRACTION]
Crystal Structure Analysis of the PDZ Domain Derived from the Tight Junction Regulating Protein [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000039744
AA Change: S29*
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228
AA Change: S29*

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087161
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113531
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117388
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117525
AA Change: S29*
SMART Domains Protein: ENSMUSP00000113837
Gene: ENSMUSG00000029228
AA Change: S29*

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121690
AA Change: S29*
SMART Domains Protein: ENSMUSP00000113565
Gene: ENSMUSG00000029228
AA Change: S29*

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
PDZ 178 253 5.33e-19 SMART
PDZ 285 358 2.27e-13 SMART
PDZ 407 484 8.27e-16 SMART
PDZ 537 614 5.71e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127396
AA Change: S29*
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228
AA Change: S29*

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153543
SMART Domains Protein: ENSMUSP00000121094
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
Blast:PDZ 2 105 9e-37 BLAST
Blast:PDZ 129 159 1e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74685717 missense probably benign 0.00
IGL01538:Lnx1 APN 5 74620155 missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74685759 missense probably benign 0.02
IGL03188:Lnx1 APN 5 74620263 missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74620347 critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74607909 splice site probably benign
R1343:Lnx1 UTSW 5 74597379 missense probably damaging 0.98
R1533:Lnx1 UTSW 5 74620017 missense probably damaging 1.00
R1681:Lnx1 UTSW 5 74685410 missense probably benign
R1714:Lnx1 UTSW 5 74607737 missense probably null 1.00
R1727:Lnx1 UTSW 5 74607916 splice site probably null
R1806:Lnx1 UTSW 5 74606049 missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74620066 missense probably benign 0.25
R2879:Lnx1 UTSW 5 74620123 missense probably benign 0.03
R2984:Lnx1 UTSW 5 74685422 nonsense probably null
R3790:Lnx1 UTSW 5 74628366 splice site probably benign
R3953:Lnx1 UTSW 5 74606089 missense probably benign
R4509:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4510:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4511:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74685543 missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4624:Lnx1 UTSW 5 74660460 intron probably benign
R4647:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4648:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4877:Lnx1 UTSW 5 74628123 missense probably benign 0.01
R4883:Lnx1 UTSW 5 74607869 missense probably benign
R5256:Lnx1 UTSW 5 74685654 missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74677569 missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74685608 nonsense probably null
R6408:Lnx1 UTSW 5 74685646 missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74607880 missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTTCAACTGCTGTAAGGC -3'
(R):5'- CTTAATCTACAGGCTCCAAGTCG -3'

Sequencing Primer
(F):5'- CTGCTGTAAGGCATTTTATTCATGC -3'
(R):5'- CCAAGTCGGGTGCATTATTATC -3'
Posted On2019-06-26