Incidental Mutation 'R7261:Aff1'
ID564610
Institutional Source Beutler Lab
Gene Symbol Aff1
Ensembl Gene ENSMUSG00000029313
Gene NameAF4/FMR2 family, member 1
Synonyms9630032B01Rik, Af4, Rob, Mllt2h
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location103692374-103855322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103828379 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 448 (S448P)
Ref Sequence ENSEMBL: ENSMUSP00000059744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]
Predicted Effect probably damaging
Transcript: ENSMUST00000031256
AA Change: S456P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: S456P

DomainStartEndE-ValueType
Pfam:AF-4 16 1223 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054979
AA Change: S448P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: S448P

DomainStartEndE-ValueType
Pfam:AF-4 8 1216 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153165
AA Change: S456P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313
AA Change: S456P

DomainStartEndE-ValueType
Pfam:AF-4 16 871 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Aff1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Aff1 APN 5 103784077 missense probably damaging 1.00
IGL02060:Aff1 APN 5 103783849 missense possibly damaging 0.51
IGL02081:Aff1 APN 5 103834305 missense probably damaging 1.00
IGL02108:Aff1 APN 5 103811109 critical splice donor site probably null
IGL03056:Aff1 APN 5 103811081 missense probably damaging 0.99
IGL03332:Aff1 APN 5 103841105 nonsense probably null
IGL03340:Aff1 APN 5 103783804 missense possibly damaging 0.76
IGL03382:Aff1 APN 5 103841060 missense possibly damaging 0.86
PIT4495001:Aff1 UTSW 5 103849525 missense probably benign 0.16
R0013:Aff1 UTSW 5 103828484 nonsense probably null
R0219:Aff1 UTSW 5 103811040 splice site probably benign
R0520:Aff1 UTSW 5 103847751 nonsense probably null
R0607:Aff1 UTSW 5 103828454 missense probably damaging 1.00
R0883:Aff1 UTSW 5 103826138 splice site probably benign
R1662:Aff1 UTSW 5 103841057 missense probably damaging 0.99
R1730:Aff1 UTSW 5 103833512 missense probably damaging 1.00
R1850:Aff1 UTSW 5 103833907 missense probably damaging 1.00
R3411:Aff1 UTSW 5 103754706 start codon destroyed probably null 0.53
R4007:Aff1 UTSW 5 103784222 missense probably benign 0.15
R4207:Aff1 UTSW 5 103818988 critical splice donor site probably null
R4702:Aff1 UTSW 5 103811069 missense probably damaging 1.00
R4730:Aff1 UTSW 5 103843073 missense possibly damaging 0.95
R4784:Aff1 UTSW 5 103847039 nonsense probably null
R5166:Aff1 UTSW 5 103754657 start gained probably benign
R5294:Aff1 UTSW 5 103811157 intron probably benign
R5435:Aff1 UTSW 5 103754332 unclassified probably benign
R5436:Aff1 UTSW 5 103783870 missense probably damaging 1.00
R6065:Aff1 UTSW 5 103842252 missense probably damaging 1.00
R6114:Aff1 UTSW 5 103842297 missense probably damaging 0.97
R6298:Aff1 UTSW 5 103754720 missense possibly damaging 0.68
R7095:Aff1 UTSW 5 103843085 missense probably damaging 0.97
R7350:Aff1 UTSW 5 103847092 missense probably benign 0.28
R7423:Aff1 UTSW 5 103847101 missense probably damaging 1.00
R7469:Aff1 UTSW 5 103833547 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCTTTCAGGAGGGGAATACC -3'
(R):5'- TCCTGCCATCTTGCATAGCG -3'

Sequencing Primer
(F):5'- GTGACCACGATTCTAACACCTTGG -3'
(R):5'- CCATCTTGCATAGCGTTCTGGAG -3'
Posted On2019-06-26