Incidental Mutation 'R7261:Vmn2r77'
ID564620
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Namevomeronasal 2, receptor 77
SynonymsEG546983
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86795141-86812032 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86811310 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 615 (K615*)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
Predicted Effect probably null
Transcript: ENSMUST00000164996
AA Change: K615*
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: K615*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86800767 missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86811664 missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86811916 missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86811649 missense probably benign
IGL01805:Vmn2r77 APN 7 86811187 missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86803016 missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86801470 missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86801555 missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86803628 nonsense probably null
IGL02185:Vmn2r77 APN 7 86795152 missense unknown
IGL02200:Vmn2r77 APN 7 86801979 missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86802016 missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86803640 nonsense probably null
IGL02557:Vmn2r77 APN 7 86795134 unclassified probably benign
IGL02659:Vmn2r77 APN 7 86800771 missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86811347 missense probably benign
IGL03180:Vmn2r77 APN 7 86801635 missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86811923 missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86811286 missense probably damaging 0.99
R0046:Vmn2r77 UTSW 7 86801938 missense possibly damaging 0.73
R0047:Vmn2r77 UTSW 7 86811650 missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86811175 missense probably benign
R0689:Vmn2r77 UTSW 7 86811664 missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86802016 missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86801746 missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86801034 critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86802186 missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86811148 missense probably damaging 1.00
R1654:Vmn2r77 UTSW 7 86811915 missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86795335 missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86801613 missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86811793 missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86801713 missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86811944 missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86811689 missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86800983 missense probably benign
R3694:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86795160 nonsense probably null
R3870:Vmn2r77 UTSW 7 86811842 missense probably damaging 1.00
R4732:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R4733:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86801807 missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86811638 missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86802133 missense probably damaging 0.98
R5469:Vmn2r77 UTSW 7 86802063 missense probably benign 0.01
R5673:Vmn2r77 UTSW 7 86812006 missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86812027 missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86811462 nonsense probably null
R5899:Vmn2r77 UTSW 7 86811716 missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86801670 missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86811749 missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86801823 missense probably benign
R6419:Vmn2r77 UTSW 7 86811559 missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86800857 missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86802078 missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86802994 missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86801815 missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86801827 missense probably benign 0.00
R7298:Vmn2r77 UTSW 7 86800771 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCAGAGGATGAGTATGCC -3'
(R):5'- AGTAGCAGCCACCTCAGTCTTC -3'

Sequencing Primer
(F):5'- TCCAGAGGATGAGTATGCCAACAC -3'
(R):5'- CTAGGACTACAGTAATTGTTTTGGC -3'
Posted On2019-06-26