Incidental Mutation 'R7261:Vps11'
ID564626
Institutional Source Beutler Lab
Gene Symbol Vps11
Ensembl Gene ENSMUSG00000032127
Gene NameVPS11, CORVET/HOPS core subunit
Synonyms1200011A11Rik
Accession Numbers

Ncbi RefSeq: NM_027889.1; MGI:1918982

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44347749-44361670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44354503 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 493 (L493P)
Ref Sequence ENSEMBL: ENSMUSP00000034644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034644] [ENSMUST00000213249] [ENSMUST00000213740] [ENSMUST00000214510]
Predicted Effect probably damaging
Transcript: ENSMUST00000034644
AA Change: L493P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034644
Gene: ENSMUSG00000032127
AA Change: L493P

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
SCOP:d1erja_ 59 292 3e-10 SMART
Blast:WD40 73 117 2e-22 BLAST
Blast:WD40 125 168 9e-24 BLAST
Blast:WD40 175 214 6e-16 BLAST
Blast:WD40 219 259 2e-20 BLAST
Pfam:Clathrin 412 548 2.7e-16 PFAM
coiled coil region 775 813 N/A INTRINSIC
RING 822 860 6.14e-5 SMART
Pfam:VPS11_C 862 908 5.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213249
Predicted Effect probably benign
Transcript: ENSMUST00000213740
Predicted Effect probably benign
Transcript: ENSMUST00000214460
Predicted Effect probably benign
Transcript: ENSMUST00000214510
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps11 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Vps11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Vps11 APN 9 44356219 splice site probably benign
IGL03135:Vps11 APN 9 44356356 missense probably benign 0.39
PIT4696001:Vps11 UTSW 9 44358189 missense possibly damaging 0.89
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0122:Vps11 UTSW 9 44354512 missense probably damaging 1.00
R0335:Vps11 UTSW 9 44353838 missense probably null 0.02
R0714:Vps11 UTSW 9 44359656 missense possibly damaging 0.90
R1068:Vps11 UTSW 9 44353019 missense probably damaging 1.00
R1873:Vps11 UTSW 9 44359936 missense probably damaging 1.00
R1991:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2068:Vps11 UTSW 9 44358316 missense probably damaging 0.99
R2084:Vps11 UTSW 9 44353261 missense probably benign 0.14
R2103:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2119:Vps11 UTSW 9 44348997 missense probably benign 0.01
R4160:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4161:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4564:Vps11 UTSW 9 44361597 missense probably damaging 1.00
R4879:Vps11 UTSW 9 44353300 missense probably benign
R5629:Vps11 UTSW 9 44356376 missense probably damaging 1.00
R5910:Vps11 UTSW 9 44359135 splice site probably null
R5988:Vps11 UTSW 9 44353924 missense probably benign 0.01
R6430:Vps11 UTSW 9 44361550 missense probably benign 0.11
R7002:Vps11 UTSW 9 44355079 missense probably damaging 1.00
R7147:Vps11 UTSW 9 44355082 nonsense probably null
R7237:Vps11 UTSW 9 44354506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCTTCCTGATAGTTCTG -3'
(R):5'- GCAAAAGGCTGGTTGGCATG -3'

Sequencing Primer
(F):5'- TGAAGAAGTGCCCCGGTC -3'
(R):5'- GTTTTTCAAGCCAGGATGTAATTGCC -3'
Posted On2019-06-26