Incidental Mutation 'R7261:Scn11a'
ID564632
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119819833 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 55 (D55N)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: D55N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: D55N

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: D55N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGACCCCAAGACTGGATTC -3'
(R):5'- AGCTGTGTTTCTGCCACAC -3'

Sequencing Primer
(F):5'- TTCAGAGAACCAGTAGTGCAC -3'
(R):5'- CACACAGTGTCTGAGCCAAGG -3'
Posted On2019-06-26