Incidental Mutation 'R7261:Fam171a2'
ID564647
Institutional Source Beutler Lab
Gene Symbol Fam171a2
Ensembl Gene ENSMUSG00000034685
Gene Namefamily with sequence similarity 171, member A2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102436981-102447682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102438074 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 620 (N620Y)
Ref Sequence ENSEMBL: ENSMUSP00000038486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]
Predicted Effect probably damaging
Transcript: ENSMUST00000049057
AA Change: N620Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685
AA Change: N620Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049460
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129997
SMART Domains Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GRAN 61 112 1.32e-22 SMART
GRAN 125 177 7.38e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177428
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Fam171a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Fam171a2 APN 11 102437848 missense possibly damaging 0.92
IGL01898:Fam171a2 APN 11 102439756 missense possibly damaging 0.88
IGL02477:Fam171a2 APN 11 102440028 missense probably benign 0.00
IGL03272:Fam171a2 APN 11 102444118 missense possibly damaging 0.58
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0632:Fam171a2 UTSW 11 102437881 missense probably damaging 0.99
R0733:Fam171a2 UTSW 11 102439722 missense possibly damaging 0.83
R1005:Fam171a2 UTSW 11 102440181 missense probably benign 0.05
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R2425:Fam171a2 UTSW 11 102438361 missense possibly damaging 0.88
R4838:Fam171a2 UTSW 11 102438685 missense possibly damaging 0.88
R4858:Fam171a2 UTSW 11 102440156 missense probably damaging 1.00
R5119:Fam171a2 UTSW 11 102438733 missense probably damaging 0.97
R5384:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5386:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5408:Fam171a2 UTSW 11 102437518 missense possibly damaging 0.71
R5457:Fam171a2 UTSW 11 102437536 missense possibly damaging 0.92
R5732:Fam171a2 UTSW 11 102439981 missense possibly damaging 0.94
R6466:Fam171a2 UTSW 11 102439885 missense probably damaging 1.00
R6931:Fam171a2 UTSW 11 102438434 missense possibly damaging 0.95
R7196:Fam171a2 UTSW 11 102438346 missense probably benign 0.04
R7295:Fam171a2 UTSW 11 102438238 missense possibly damaging 0.85
R7419:Fam171a2 UTSW 11 102438802 missense possibly damaging 0.95
R7422:Fam171a2 UTSW 11 102438665 missense probably benign 0.29
R7454:Fam171a2 UTSW 11 102439717 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTAGCGAGTTGTCCTCCGG -3'
(R):5'- GGTGATCCCCGCACACTATG -3'

Sequencing Primer
(F):5'- TGAGTCCAGGCTGGCATC -3'
(R):5'- ACACTATGTGCGCCTGGG -3'
Posted On2019-06-26