Incidental Mutation 'R7261:Diaph3'
ID564655
Institutional Source Beutler Lab
Gene Symbol Diaph3
Ensembl Gene ENSMUSG00000022021
Gene Namediaphanous related formin 3
Synonyms4930417P13Rik, Diap3, mDia2, p134MDia2, Drf3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location86655367-87141235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86965457 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 666 (C666G)
Ref Sequence ENSEMBL: ENSMUSP00000129420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022599] [ENSMUST00000168889] [ENSMUST00000228000]
Predicted Effect probably benign
Transcript: ENSMUST00000022599
AA Change: C666G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022599
Gene: ENSMUSG00000022021
AA Change: C666G

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.88e-180 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168889
AA Change: C666G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129420
Gene: ENSMUSG00000022021
AA Change: C666G

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.2e-181 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228000
AA Change: C655G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for disruption of this gene display embryonic mortality and abnormal cytokinesis of RBC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Diaph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Diaph3 APN 14 87002871 missense probably benign
IGL00809:Diaph3 APN 14 87000027 missense probably damaging 0.98
IGL01419:Diaph3 APN 14 86965553 nonsense probably null
IGL01577:Diaph3 APN 14 86906031 missense probably damaging 0.99
IGL01718:Diaph3 APN 14 86656338 missense unknown
IGL01736:Diaph3 APN 14 86918846 missense probably benign 0.01
IGL01893:Diaph3 APN 14 86918852 missense possibly damaging 0.71
IGL02316:Diaph3 APN 14 86986115 missense possibly damaging 0.88
IGL02527:Diaph3 APN 14 86810359 missense possibly damaging 0.47
IGL02586:Diaph3 APN 14 86986076 nonsense probably null
IGL02749:Diaph3 APN 14 86918825 missense probably damaging 0.99
IGL02892:Diaph3 APN 14 86866630 nonsense probably null
IGL03069:Diaph3 APN 14 86772119 missense probably damaging 1.00
IGL03191:Diaph3 APN 14 87073302 missense possibly damaging 0.75
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0011:Diaph3 UTSW 14 86866408 missense probably damaging 1.00
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0285:Diaph3 UTSW 14 87115024 missense possibly damaging 0.86
R0359:Diaph3 UTSW 14 86969502 missense probably benign 0.26
R0505:Diaph3 UTSW 14 87090964 splice site probably benign
R0551:Diaph3 UTSW 14 86910100 missense probably benign 0.45
R1295:Diaph3 UTSW 14 87007399 missense probably damaging 1.00
R1539:Diaph3 UTSW 14 86656480 missense probably damaging 1.00
R1602:Diaph3 UTSW 14 87091158 splice site probably benign
R1725:Diaph3 UTSW 14 86966323 critical splice donor site probably null
R1745:Diaph3 UTSW 14 86966560 missense probably damaging 0.96
R1747:Diaph3 UTSW 14 87073337 missense probably damaging 0.98
R1772:Diaph3 UTSW 14 86965549 missense probably damaging 1.00
R1914:Diaph3 UTSW 14 86656485 missense probably damaging 0.98
R1942:Diaph3 UTSW 14 87141120 utr 5 prime probably benign
R1999:Diaph3 UTSW 14 86984866 missense possibly damaging 0.53
R2291:Diaph3 UTSW 14 86966446 missense probably damaging 1.00
R2999:Diaph3 UTSW 14 86772094 missense probably damaging 0.99
R3158:Diaph3 UTSW 14 86656456 missense possibly damaging 0.84
R3612:Diaph3 UTSW 14 87037457 missense probably null 0.89
R4170:Diaph3 UTSW 14 86985707 missense probably damaging 1.00
R4594:Diaph3 UTSW 14 86986037 missense probably damaging 0.99
R4912:Diaph3 UTSW 14 87007199 missense probably damaging 1.00
R4930:Diaph3 UTSW 14 87141166 start gained probably benign
R5063:Diaph3 UTSW 14 86984870 missense probably damaging 1.00
R5093:Diaph3 UTSW 14 86984800 missense probably damaging 1.00
R5267:Diaph3 UTSW 14 86656553 missense probably benign 0.03
R5289:Diaph3 UTSW 14 86981678 missense probably damaging 1.00
R5549:Diaph3 UTSW 14 86978670 missense probably benign 0.14
R5936:Diaph3 UTSW 14 86772116 missense possibly damaging 0.53
R5966:Diaph3 UTSW 14 86984825 missense probably damaging 1.00
R6236:Diaph3 UTSW 14 87037568 nonsense probably null
R6323:Diaph3 UTSW 14 86966453 missense probably benign 0.03
R6331:Diaph3 UTSW 14 86866540 missense probably damaging 1.00
R6362:Diaph3 UTSW 14 86772130 missense probably damaging 1.00
R6398:Diaph3 UTSW 14 86866486 missense probably damaging 1.00
R6408:Diaph3 UTSW 14 86828994 missense possibly damaging 0.68
R6469:Diaph3 UTSW 14 86656538 missense possibly damaging 0.71
R6519:Diaph3 UTSW 14 86966335 missense probably damaging 1.00
R7283:Diaph3 UTSW 14 86866584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCATGTTATCACCTGTGTG -3'
(R):5'- GAGGTGACTTCATGACCATTTGC -3'

Sequencing Primer
(F):5'- TCACCTGTGTGAGAAAAATTGC -3'
(R):5'- GATCCCTGGGTTGCCTGTC -3'
Posted On2019-06-26