Incidental Mutation 'R7261:Enthd1'
ID564656
Institutional Source Beutler Lab
Gene Symbol Enthd1
Ensembl Gene ENSMUSG00000050439
Gene NameENTH domain containing 1
SynonymsLOC383075
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location80452240-80565156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80560215 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 46 (N46K)
Ref Sequence ENSEMBL: ENSMUSP00000094072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096347] [ENSMUST00000229110]
Predicted Effect probably damaging
Transcript: ENSMUST00000096347
AA Change: N46K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094072
Gene: ENSMUSG00000050439
AA Change: N46K

DomainStartEndE-ValueType
ENTH 15 141 1.53e-50 SMART
low complexity region 419 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229110
AA Change: N46K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Enthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Enthd1 APN 15 80452451 missense probably damaging 0.98
IGL02127:Enthd1 APN 15 80452742 missense probably damaging 1.00
PIT4151001:Enthd1 UTSW 15 80452736 missense probably damaging 1.00
R0190:Enthd1 UTSW 15 80534494 splice site probably null
R1237:Enthd1 UTSW 15 80534598 missense probably damaging 1.00
R1616:Enthd1 UTSW 15 80452385 missense probably damaging 1.00
R1697:Enthd1 UTSW 15 80452923 missense probably damaging 1.00
R1826:Enthd1 UTSW 15 80474281 missense probably damaging 0.99
R2037:Enthd1 UTSW 15 80560349 missense possibly damaging 0.86
R3420:Enthd1 UTSW 15 80560024 missense probably damaging 1.00
R3814:Enthd1 UTSW 15 80452682 missense probably benign 0.11
R4049:Enthd1 UTSW 15 80560039 missense probably damaging 0.99
R4403:Enthd1 UTSW 15 80452824 missense probably benign 0.00
R4720:Enthd1 UTSW 15 80560309 missense probably damaging 1.00
R6062:Enthd1 UTSW 15 80452715 missense probably damaging 0.96
R6143:Enthd1 UTSW 15 80509286 missense possibly damaging 0.96
R6984:Enthd1 UTSW 15 80560108 missense probably damaging 1.00
R7062:Enthd1 UTSW 15 80452544 missense probably damaging 1.00
R7105:Enthd1 UTSW 15 80509209 missense probably benign 0.17
R7177:Enthd1 UTSW 15 80474214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGAAGGTTACAGACGCCC -3'
(R):5'- AACTTGGGACGAATCTGTCAGG -3'

Sequencing Primer
(F):5'- AAGGTTACAGACGCCCTCTCTG -3'
(R):5'- GAATCTGTCAGGCGCTCTGTAAAC -3'
Posted On2019-06-26