Incidental Mutation 'R7261:Ndufs8'
ID564668
Institutional Source Beutler Lab
Gene Symbol Ndufs8
Ensembl Gene ENSMUSG00000059734
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 8
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R7261 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3908870-3912717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3911606 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 23 (N23K)
Ref Sequence ENSEMBL: ENSMUSP00000074600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000051803] [ENSMUST00000075092] [ENSMUST00000126070] [ENSMUST00000135070]
Predicted Effect probably benign
Transcript: ENSMUST00000001801
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051803
SMART Domains Protein: ENSMUSP00000056276
Gene: ENSMUSG00000024885

DomainStartEndE-ValueType
Pfam:Aldedh 2 428 7.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075092
AA Change: N23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074600
Gene: ENSMUSG00000059734
AA Change: N23K

DomainStartEndE-ValueType
Pfam:Fer4_10 108 163 2.4e-9 PFAM
Pfam:Fer4 109 129 1.1e-6 PFAM
Pfam:Fer4_4 110 126 2e-5 PFAM
Pfam:Fer4_7 112 166 1e-13 PFAM
Pfam:Fer4_9 112 167 8.8e-10 PFAM
Pfam:Fer4 145 168 5.3e-10 PFAM
Pfam:Fer4_4 149 173 3.1e-3 PFAM
low complexity region 181 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126070
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial NADH:ubiquinone oxidoreductase, or Complex I, a multimeric enzyme of the respiratory chain responsible for NADH oxidation, ubiquinone reduction, and the ejection of protons from mitochondria. The encoded protein is involved in the binding of two of the six to eight iron-sulfur clusters of Complex I and, as such, is required in the electron transfer process. Mutations in this gene have been associated with Leigh syndrome. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
D130052B06Rik GTACTGGTGATCTGTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTAT GT 11: 33,623,342 probably null Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Svs1 GGGTGGCCCTCAAAAGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAA GGGTGGCCCTCAA 6: 48,988,004 probably benign Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Ndufs8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Ndufs8 APN 19 3911740 missense probably benign
IGL02958:Ndufs8 APN 19 3911232 missense probably benign 0.09
R4279:Ndufs8 UTSW 19 3911014 missense probably damaging 1.00
R6072:Ndufs8 UTSW 19 3909275 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCAGCTCTTTCCTGTCACATG -3'
(R):5'- AGGAGGGCAGTTTTAGACCC -3'

Sequencing Primer
(F):5'- CGCCTTTGATGGTACTACAGTGAC -3'
(R):5'- GAGGGCAGTTTTAGACCCTTCTC -3'
Posted On2019-06-26