Incidental Mutation 'R7262:Flot2'
ID564698
Institutional Source Beutler Lab
Gene Symbol Flot2
Ensembl Gene ENSMUSG00000061981
Gene Nameflotillin 2
SynonymsEsa, reggie-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78037931-78060434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78057349 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 145 (M145T)
Ref Sequence ENSEMBL: ENSMUSP00000072136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072289] [ENSMUST00000073660] [ENSMUST00000100784] [ENSMUST00000148162]
PDB Structure
Solution Structure of the Band 7 Domain of the mouse Flotillin 2 Protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000072289
AA Change: M145T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072136
Gene: ENSMUSG00000061981
AA Change: M145T

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 6.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073660
AA Change: M145T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073342
Gene: ENSMUSG00000061981
AA Change: M145T

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 5.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100784
AA Change: M96T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098347
Gene: ENSMUSG00000061981
AA Change: M96T

DomainStartEndE-ValueType
PHB 38 220 1.34e-10 SMART
Blast:PHB 277 347 2e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148162
SMART Domains Protein: ENSMUSP00000133147
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
Blast:PHB 2 74 2e-34 BLAST
PDB:1WIN|A 40 74 2e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced metastase into the lungs in a breast cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Flot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Flot2 APN 11 78049507 missense probably damaging 1.00
IGL02965:Flot2 APN 11 78059205 missense possibly damaging 0.50
PIT4382001:Flot2 UTSW 11 78053367 missense possibly damaging 0.85
R0330:Flot2 UTSW 11 78058958 missense possibly damaging 0.94
R1200:Flot2 UTSW 11 78054805 missense probably damaging 1.00
R1700:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1701:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1735:Flot2 UTSW 11 78058005 missense probably benign 0.05
R1992:Flot2 UTSW 11 78058619 missense probably damaging 0.97
R4812:Flot2 UTSW 11 78053365 missense probably damaging 0.99
R4840:Flot2 UTSW 11 78057513 missense probably damaging 1.00
R4927:Flot2 UTSW 11 78059062 missense probably damaging 0.98
R5396:Flot2 UTSW 11 78049488 nonsense probably null
R6865:Flot2 UTSW 11 78049492 missense probably benign 0.05
R7085:Flot2 UTSW 11 78058074 missense possibly damaging 0.94
R7286:Flot2 UTSW 11 78054786 missense probably benign 0.05
R7350:Flot2 UTSW 11 78057976 missense probably damaging 1.00
R7359:Flot2 UTSW 11 78058557 missense probably benign 0.25
R7498:Flot2 UTSW 11 78053362 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCAGCTCAGACTGCTTG -3'
(R):5'- TGCATCTCTCTGCACCACAG -3'

Sequencing Primer
(F):5'- CCCTTGCGTGCACTCAG -3'
(R):5'- AGCAGTCTGTGTCTTGCCCAG -3'
Posted On2019-06-26