Incidental Mutation 'R7263:Ccdc159'
ID564759
Institutional Source Beutler Lab
Gene Symbol Ccdc159
Ensembl Gene ENSMUSG00000006241
Gene Namecoiled-coil domain containing 159
Synonyms2510048L02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7263 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21927471-21935872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21931711 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 148 (M148T)
Ref Sequence ENSEMBL: ENSMUSP00000126474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006403] [ENSMUST00000046831] [ENSMUST00000170304] [ENSMUST00000213698] [ENSMUST00000214569] [ENSMUST00000214734] [ENSMUST00000216710]
Predicted Effect probably benign
Transcript: ENSMUST00000006403
AA Change: M140T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006403
Gene: ENSMUSG00000006241
AA Change: M140T

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
coiled coil region 152 172 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
coiled coil region 261 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046831
SMART Domains Protein: ENSMUSP00000048832
Gene: ENSMUSG00000040883

DomainStartEndE-ValueType
Pfam:DUF4149 17 119 1.2e-27 PFAM
transmembrane domain 164 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170304
AA Change: M148T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126474
Gene: ENSMUSG00000006241
AA Change: M148T

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 160 180 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
coiled coil region 269 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213698
Predicted Effect probably benign
Transcript: ENSMUST00000214569
Predicted Effect probably benign
Transcript: ENSMUST00000214734
AA Change: M148T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably null
Transcript: ENSMUST00000216710
AA Change: M1T

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Ccdc159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Ccdc159 APN 9 21929469 missense possibly damaging 0.83
IGL02322:Ccdc159 APN 9 21929373 missense possibly damaging 0.46
IGL03156:Ccdc159 APN 9 21929475 missense probably benign
IGL03382:Ccdc159 APN 9 21931696 splice site probably null
R1622:Ccdc159 UTSW 9 21929370 missense possibly damaging 0.66
R2076:Ccdc159 UTSW 9 21929506 unclassified probably null
R3905:Ccdc159 UTSW 9 21934519 critical splice donor site probably null
R4083:Ccdc159 UTSW 9 21929403 missense possibly damaging 0.83
R4625:Ccdc159 UTSW 9 21929466 missense probably benign
R4700:Ccdc159 UTSW 9 21927731 splice site probably null
R5004:Ccdc159 UTSW 9 21932945 missense probably damaging 1.00
R5743:Ccdc159 UTSW 9 21929390 missense probably benign 0.19
R6245:Ccdc159 UTSW 9 21935568 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAGACATTTGGGTTTCTATCCC -3'
(R):5'- TCAGGAACTCGAAAGCCTGAG -3'

Sequencing Primer
(F):5'- AGCCACCTTGGAGGGATACTTTC -3'
(R):5'- GGGGCAGGAGATGAGGCC -3'
Posted On2019-06-26