Incidental Mutation 'R7263:Elp3'
ID564769
Institutional Source Beutler Lab
Gene Symbol Elp3
Ensembl Gene ENSMUSG00000022031
Gene Nameelongator acetyltransferase complex subunit 3
SynonymsKAT9, 2610507P14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location65530449-65593075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65565333 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 272 (D272G)
Ref Sequence ENSEMBL: ENSMUSP00000022609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022609] [ENSMUST00000224743] [ENSMUST00000225355]
Predicted Effect probably damaging
Transcript: ENSMUST00000022609
AA Change: D272G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022609
Gene: ENSMUSG00000022031
AA Change: D272G

DomainStartEndE-ValueType
Elp3 108 370 1.36e-37 SMART
Blast:Elp3 387 431 2e-19 BLAST
Pfam:Acetyltransf_1 460 555 1.1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224743
AA Change: D253G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000225355
AA Change: D253G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ELP3 is the catalytic subunit of the histone acetyltransferase elongator complex, which contributes to transcript elongation and also regulates the maturation of projection neurons (Creppe et al., 2009 [PubMed 19185337]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Embryos homozygous for a null gene trap mutation show severe growth retardation and die prior to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Elp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02477:Elp3 APN 14 65563311 missense probably benign
R0052:Elp3 UTSW 14 65531526 makesense probably null
R0333:Elp3 UTSW 14 65590593 missense probably benign 0.05
R0513:Elp3 UTSW 14 65563246 splice site probably null
R0980:Elp3 UTSW 14 65577953 missense probably damaging 1.00
R1137:Elp3 UTSW 14 65547921 missense probably damaging 0.99
R1259:Elp3 UTSW 14 65547939 missense probably damaging 0.96
R1378:Elp3 UTSW 14 65592931 missense probably benign
R1722:Elp3 UTSW 14 65551397 missense probably benign 0.02
R1789:Elp3 UTSW 14 65547919 missense probably damaging 1.00
R3843:Elp3 UTSW 14 65565483 splice site probably null
R4125:Elp3 UTSW 14 65560181 missense possibly damaging 0.64
R4196:Elp3 UTSW 14 65548002 missense probably damaging 1.00
R4400:Elp3 UTSW 14 65548090 missense possibly damaging 0.89
R4420:Elp3 UTSW 14 65580791 missense probably damaging 1.00
R4516:Elp3 UTSW 14 65547877 missense possibly damaging 0.46
R4764:Elp3 UTSW 14 65582929 missense probably damaging 1.00
R4838:Elp3 UTSW 14 65547864 critical splice donor site probably null
R5052:Elp3 UTSW 14 65577940 missense probably damaging 1.00
R5111:Elp3 UTSW 14 65560236 missense probably damaging 1.00
R5665:Elp3 UTSW 14 65551402 missense possibly damaging 0.80
R5702:Elp3 UTSW 14 65577982 missense probably damaging 1.00
R5754:Elp3 UTSW 14 65547990 missense probably damaging 1.00
R5927:Elp3 UTSW 14 65582177 missense probably damaging 1.00
R5999:Elp3 UTSW 14 65531540 missense probably benign 0.01
R6378:Elp3 UTSW 14 65592971 nonsense probably null
R6384:Elp3 UTSW 14 65560211 missense probably damaging 1.00
R6601:Elp3 UTSW 14 65547039 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTCCCTGACTCAGTGAC -3'
(R):5'- TGACCCCAGGTGTGTCATTTTAC -3'

Sequencing Primer
(F):5'- CCTGACTCAGTGACACGTTTTTAGG -3'
(R):5'- CAGGTGTGTCATTTTACTTCTGC -3'
Posted On2019-06-26