Incidental Mutation 'R7263:Rgs22'
ID564773
Institutional Source Beutler Lab
Gene Symbol Rgs22
Ensembl Gene ENSMUSG00000037627
Gene Nameregulator of G-protein signalling 22
Synonyms
Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36009479-36140400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36015643 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1156 (S1156P)
Ref Sequence ENSEMBL: ENSMUSP00000134259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172831]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172831
AA Change: S1156P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: S1156P

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 173 179 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
RGS 845 973 3.15e-2 SMART
RGS 1014 1134 1.56e-15 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133703
Gene: ENSMUSG00000037627
AA Change: S145P

DomainStartEndE-ValueType
RGS 4 124 1.56e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Rgs22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Rgs22 APN 15 36099931 missense possibly damaging 0.93
IGL00594:Rgs22 APN 15 36083631 missense probably benign 0.00
IGL01464:Rgs22 APN 15 36083641 missense possibly damaging 0.90
IGL01686:Rgs22 APN 15 36103835 missense probably benign 0.00
IGL01761:Rgs22 APN 15 36103751 missense probably damaging 0.99
IGL02045:Rgs22 APN 15 36013154 missense probably benign 0.33
IGL02378:Rgs22 APN 15 36103805 missense probably benign 0.00
IGL02490:Rgs22 APN 15 36054847 missense probably damaging 1.00
IGL03219:Rgs22 APN 15 36107048 missense probably damaging 1.00
IGL03229:Rgs22 APN 15 36015779 splice site probably benign
IGL03328:Rgs22 APN 15 36043204 critical splice donor site probably null
3-1:Rgs22 UTSW 15 36100036 missense possibly damaging 0.48
R0254:Rgs22 UTSW 15 36104552 missense probably damaging 0.99
R0463:Rgs22 UTSW 15 36092938 missense probably damaging 1.00
R0467:Rgs22 UTSW 15 36099795 nonsense probably null
R0486:Rgs22 UTSW 15 36092882 missense probably damaging 0.98
R0554:Rgs22 UTSW 15 36054709 missense probably benign 0.10
R0602:Rgs22 UTSW 15 36139872 splice site probably benign
R0906:Rgs22 UTSW 15 36103902 intron probably benign
R1159:Rgs22 UTSW 15 36040693 missense probably damaging 1.00
R1300:Rgs22 UTSW 15 36101762 missense probably benign 0.43
R1439:Rgs22 UTSW 15 36025793 splice site probably benign
R1491:Rgs22 UTSW 15 36092901 missense probably damaging 0.98
R1502:Rgs22 UTSW 15 36080851 missense probably damaging 1.00
R1514:Rgs22 UTSW 15 36013100 missense probably benign 0.00
R1538:Rgs22 UTSW 15 36048776 missense probably damaging 1.00
R1784:Rgs22 UTSW 15 36087436 missense probably damaging 1.00
R1938:Rgs22 UTSW 15 36101804 missense probably benign 0.00
R1972:Rgs22 UTSW 15 36103836 missense probably benign 0.01
R2109:Rgs22 UTSW 15 36099734 nonsense probably null
R2208:Rgs22 UTSW 15 36050232 missense probably benign 0.01
R3696:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3697:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3698:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3879:Rgs22 UTSW 15 36106905 missense possibly damaging 0.52
R4080:Rgs22 UTSW 15 36107076 missense probably damaging 1.00
R4363:Rgs22 UTSW 15 36103874 missense probably damaging 0.99
R4591:Rgs22 UTSW 15 36100136 missense probably benign 0.01
R4673:Rgs22 UTSW 15 36099933 missense probably benign 0.04
R4829:Rgs22 UTSW 15 36103888 missense probably damaging 1.00
R4831:Rgs22 UTSW 15 36050148 missense probably benign 0.00
R4865:Rgs22 UTSW 15 36100212 missense probably damaging 1.00
R4907:Rgs22 UTSW 15 36087424 missense possibly damaging 0.61
R4944:Rgs22 UTSW 15 36025942 missense possibly damaging 0.83
R4975:Rgs22 UTSW 15 36054876 nonsense probably null
R5056:Rgs22 UTSW 15 36050245 unclassified probably null
R5126:Rgs22 UTSW 15 36040644 missense probably damaging 0.96
R5138:Rgs22 UTSW 15 36099788 missense probably benign 0.04
R5444:Rgs22 UTSW 15 36015627 missense possibly damaging 0.83
R5507:Rgs22 UTSW 15 36099652 missense probably damaging 0.99
R5640:Rgs22 UTSW 15 36106955 missense probably benign 0.00
R5969:Rgs22 UTSW 15 36015636 missense probably benign 0.00
R6005:Rgs22 UTSW 15 36010567 missense probably benign 0.39
R6053:Rgs22 UTSW 15 36100007 missense probably benign 0.04
R6134:Rgs22 UTSW 15 36107048 missense probably damaging 1.00
R6230:Rgs22 UTSW 15 36100030 missense probably benign 0.02
R6295:Rgs22 UTSW 15 36087374 missense probably benign 0.00
R6352:Rgs22 UTSW 15 36092921 missense probably damaging 1.00
R6809:Rgs22 UTSW 15 36048764 missense probably damaging 1.00
R6900:Rgs22 UTSW 15 36010747 missense possibly damaging 0.61
R6947:Rgs22 UTSW 15 36103890 critical splice acceptor site probably null
R7102:Rgs22 UTSW 15 36122313 missense probably damaging 1.00
R7126:Rgs22 UTSW 15 36103808 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATTCAGAACAGCCGGGTTG -3'
(R):5'- AGAGAAGCTAATCCTCTATTGTGG -3'

Sequencing Primer
(F):5'- GCTGTGAAGGAAGGCTTTGCAG -3'
(R):5'- CCTCTATTGTGGTATACTAGAG -3'
Posted On2019-06-26