Incidental Mutation 'R7264:Serinc2'
ID564800
Institutional Source Beutler Lab
Gene Symbol Serinc2
Ensembl Gene ENSMUSG00000023232
Gene Nameserine incorporator 2
SynonymsFKSG84, 2310004K20Rik, TDE2, Tde2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7264 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location130253495-130279205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130258259 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 271 (V271I)
Ref Sequence ENSEMBL: ENSMUSP00000112535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105996] [ENSMUST00000120126] [ENSMUST00000122374] [ENSMUST00000146478]
Predicted Effect probably benign
Transcript: ENSMUST00000105996
AA Change: V326I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232
AA Change: V326I

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120126
AA Change: V335I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232
AA Change: V335I

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122374
AA Change: V271I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232
AA Change: V271I

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146478
SMART Domains Protein: ENSMUSP00000115198
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 148 1.9e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,334 S200P not run Het
Adora3 C A 3: 105,904,825 T9K probably benign Het
Ankib1 T A 5: 3,755,739 N176I probably damaging Het
Ankle2 G A 5: 110,237,823 G346D probably damaging Het
Anks1b T A 10: 90,512,870 M800K probably benign Het
Arhgef16 C T 4: 154,280,930 G576D probably damaging Het
BC030867 T A 11: 102,255,596 C233S probably benign Het
C2cd2 C A 16: 97,876,219 probably null Het
Cacna1c T C 6: 118,602,195 N1847S Het
Camta1 A G 4: 151,453,399 I108T probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Cep192 A G 18: 67,820,355 Y481C probably damaging Het
Cep250 A G 2: 155,979,151 E887G probably damaging Het
Clcn1 C A 6: 42,298,838 A298D probably damaging Het
Col11a1 A G 3: 114,185,599 N1305S unknown Het
Depdc5 T C 5: 32,967,745 V1155A probably benign Het
Dnah1 A T 14: 31,269,894 D3050E probably benign Het
Dnah7a T C 1: 53,518,814 D2147G probably benign Het
Fbxl4 T C 4: 22,386,145 Y251H possibly damaging Het
Gm19410 A G 8: 35,785,766 M622V probably benign Het
Gm3402 T A 5: 146,514,662 M110K probably damaging Het
Gm4778 C T 3: 94,265,738 H14Y possibly damaging Het
Gm8257 T A 14: 44,656,360 E82D probably damaging Het
Gne T A 4: 44,042,175 I498F probably damaging Het
Gstcd C T 3: 133,084,779 V76I probably benign Het
Hgs G T 11: 120,474,313 V176L probably benign Het
Igbp1b T C 6: 138,658,110 N112S possibly damaging Het
Itga11 A T 9: 62,745,908 T355S probably benign Het
Lama1 A T 17: 67,743,297 H301L Het
Lhx9 T C 1: 138,832,751 D296G probably damaging Het
Lrp1 C T 10: 127,592,093 G537D probably damaging Het
Mroh2b A G 15: 4,921,362 I581V possibly damaging Het
Mrps36 A G 13: 100,739,199 S36P probably benign Het
Olfr618 T A 7: 103,597,748 I144N probably damaging Het
Plcb4 A T 2: 135,965,080 N547I probably benign Het
Plch2 T A 4: 154,998,967 M505L probably damaging Het
Prg4 T A 1: 150,454,067 N154Y not run Het
Rev1 A T 1: 38,085,601 V420D probably damaging Het
Rin3 A G 12: 102,390,115 I972V probably benign Het
Rtel1 T C 2: 181,351,861 L775P not run Het
Scarf2 G T 16: 17,803,290 C274F possibly damaging Het
Slpi C A 2: 164,356,402 probably benign Het
Stxbp6 T C 12: 44,901,999 D109G probably damaging Het
Tmem74 G A 15: 43,867,468 L60F probably benign Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trrap T C 5: 144,814,523 S1610P probably benign Het
Ttc33 C T 15: 5,217,237 Q175* probably null Het
Usp34 A G 11: 23,333,566 T106A probably benign Het
Vmn1r204 A G 13: 22,556,997 D266G probably benign Het
Wdfy3 C A 5: 101,855,523 A2905S probably benign Het
Wfs1 A G 5: 36,967,846 L567P probably damaging Het
Zfp42 T C 8: 43,296,275 E63G probably damaging Het
Zfp957 A G 14: 79,213,640 F240L probably damaging Het
Zgrf1 A T 3: 127,563,569 M815L probably benign Het
Other mutations in Serinc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Serinc2 APN 4 130264408 missense possibly damaging 0.88
IGL02031:Serinc2 APN 4 130264444 nonsense probably null
IGL02551:Serinc2 APN 4 130260774 missense probably benign 0.01
R1455:Serinc2 UTSW 4 130264340 missense probably damaging 0.96
R1520:Serinc2 UTSW 4 130260750 missense probably benign 0.00
R2059:Serinc2 UTSW 4 130260785 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R3160:Serinc2 UTSW 4 130260735 missense probably benign
R3162:Serinc2 UTSW 4 130260735 missense probably benign
R4497:Serinc2 UTSW 4 130254054 missense possibly damaging 0.67
R4735:Serinc2 UTSW 4 130263645 missense probably benign 0.13
R4987:Serinc2 UTSW 4 130263027 unclassified probably null
R5569:Serinc2 UTSW 4 130278479 missense probably benign 0.17
R5681:Serinc2 UTSW 4 130265076 missense probably damaging 1.00
R5946:Serinc2 UTSW 4 130255521 missense possibly damaging 0.91
R6556:Serinc2 UTSW 4 130258271 missense probably damaging 1.00
R6898:Serinc2 UTSW 4 130255442 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCGTCTGGTCCATAGCATTG -3'
(R):5'- TCAAAGTTCCCTGACTCGTAG -3'

Sequencing Primer
(F):5'- TGAAGATCTGAGTTCAATCCCCGG -3'
(R):5'- TGACTCGTAGATCCAGTCAGC -3'
Posted On2019-06-26