Incidental Mutation 'R7264:Olfr618'
ID564815
Institutional Source Beutler Lab
Gene Symbol Olfr618
Ensembl Gene ENSMUSG00000073945
Gene Nameolfactory receptor 618
SynonymsMOR31-9, GA_x6K02T2PBJ9-6320148-6321104
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7264 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103590103-103600448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103597748 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 144 (I144N)
Ref Sequence ENSEMBL: ENSMUSP00000151147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098197] [ENSMUST00000214883] [ENSMUST00000215732]
Predicted Effect probably damaging
Transcript: ENSMUST00000098197
AA Change: I144N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095799
Gene: ENSMUSG00000073945
AA Change: I144N

DomainStartEndE-ValueType
Pfam:7tm_4 34 314 3.1e-109 PFAM
Pfam:7TM_GPCR_Srsx 38 311 6.3e-12 PFAM
Pfam:7tm_1 44 296 8.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214883
AA Change: I144N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215732
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,334 S200P not run Het
Adora3 C A 3: 105,904,825 T9K probably benign Het
Ankib1 T A 5: 3,755,739 N176I probably damaging Het
Ankle2 G A 5: 110,237,823 G346D probably damaging Het
Anks1b T A 10: 90,512,870 M800K probably benign Het
Arhgef16 C T 4: 154,280,930 G576D probably damaging Het
BC030867 T A 11: 102,255,596 C233S probably benign Het
C2cd2 C A 16: 97,876,219 probably null Het
Cacna1c T C 6: 118,602,195 N1847S Het
Camta1 A G 4: 151,453,399 I108T probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Cep192 A G 18: 67,820,355 Y481C probably damaging Het
Cep250 A G 2: 155,979,151 E887G probably damaging Het
Clcn1 C A 6: 42,298,838 A298D probably damaging Het
Col11a1 A G 3: 114,185,599 N1305S unknown Het
Depdc5 T C 5: 32,967,745 V1155A probably benign Het
Dnah1 A T 14: 31,269,894 D3050E probably benign Het
Dnah7a T C 1: 53,518,814 D2147G probably benign Het
Fbxl4 T C 4: 22,386,145 Y251H possibly damaging Het
Gm19410 A G 8: 35,785,766 M622V probably benign Het
Gm3402 T A 5: 146,514,662 M110K probably damaging Het
Gm4778 C T 3: 94,265,738 H14Y possibly damaging Het
Gm8257 T A 14: 44,656,360 E82D probably damaging Het
Gne T A 4: 44,042,175 I498F probably damaging Het
Gstcd C T 3: 133,084,779 V76I probably benign Het
Hgs G T 11: 120,474,313 V176L probably benign Het
Igbp1b T C 6: 138,658,110 N112S possibly damaging Het
Itga11 A T 9: 62,745,908 T355S probably benign Het
Lama1 A T 17: 67,743,297 H301L Het
Lhx9 T C 1: 138,832,751 D296G probably damaging Het
Lrp1 C T 10: 127,592,093 G537D probably damaging Het
Mroh2b A G 15: 4,921,362 I581V possibly damaging Het
Mrps36 A G 13: 100,739,199 S36P probably benign Het
Plcb4 A T 2: 135,965,080 N547I probably benign Het
Plch2 T A 4: 154,998,967 M505L probably damaging Het
Prg4 T A 1: 150,454,067 N154Y not run Het
Rev1 A T 1: 38,085,601 V420D probably damaging Het
Rin3 A G 12: 102,390,115 I972V probably benign Het
Rtel1 T C 2: 181,351,861 L775P not run Het
Scarf2 G T 16: 17,803,290 C274F possibly damaging Het
Serinc2 C T 4: 130,258,259 V271I probably benign Het
Slpi C A 2: 164,356,402 probably benign Het
Stxbp6 T C 12: 44,901,999 D109G probably damaging Het
Tmem74 G A 15: 43,867,468 L60F probably benign Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trrap T C 5: 144,814,523 S1610P probably benign Het
Ttc33 C T 15: 5,217,237 Q175* probably null Het
Usp34 A G 11: 23,333,566 T106A probably benign Het
Vmn1r204 A G 13: 22,556,997 D266G probably benign Het
Wdfy3 C A 5: 101,855,523 A2905S probably benign Het
Wfs1 A G 5: 36,967,846 L567P probably damaging Het
Zfp42 T C 8: 43,296,275 E63G probably damaging Het
Zfp957 A G 14: 79,213,640 F240L probably damaging Het
Zgrf1 A T 3: 127,563,569 M815L probably benign Het
Other mutations in Olfr618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr618 APN 7 103598162 missense possibly damaging 0.65
IGL00963:Olfr618 APN 7 103597637 unclassified probably null
IGL01772:Olfr618 APN 7 103597913 missense probably benign 0.12
IGL02014:Olfr618 APN 7 103597730 missense probably damaging 1.00
IGL03409:Olfr618 APN 7 103597367 missense possibly damaging 0.51
R0087:Olfr618 UTSW 7 103597721 missense probably benign 0.44
R0831:Olfr618 UTSW 7 103598131 missense probably benign 0.02
R1779:Olfr618 UTSW 7 103597900 missense probably damaging 1.00
R1909:Olfr618 UTSW 7 103597343 missense probably benign 0.01
R5903:Olfr618 UTSW 7 103597921 nonsense probably null
R5952:Olfr618 UTSW 7 103597967 missense probably damaging 1.00
R6328:Olfr618 UTSW 7 103597866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACGCCAAAAGTTCTTGC -3'
(R):5'- CTAGGCCTATGGAAAATAAAGGCAC -3'

Sequencing Primer
(F):5'- CAAAAGTTCTTGCCATCTTTTGG -3'
(R):5'- TGGAAAATAAAGGCACAGTCATTCC -3'
Posted On2019-06-26