Incidental Mutation 'R7264:Mroh2b'
ID564832
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7264 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4921362 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 581 (I581V)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045736
AA Change: I581V

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: I581V

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,334 S200P not run Het
Adora3 C A 3: 105,904,825 T9K probably benign Het
Ankib1 T A 5: 3,755,739 N176I probably damaging Het
Ankle2 G A 5: 110,237,823 G346D probably damaging Het
Anks1b T A 10: 90,512,870 M800K probably benign Het
Arhgef16 C T 4: 154,280,930 G576D probably damaging Het
BC030867 T A 11: 102,255,596 C233S probably benign Het
C2cd2 C A 16: 97,876,219 probably null Het
Cacna1c T C 6: 118,602,195 N1847S Het
Camta1 A G 4: 151,453,399 I108T probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Cep192 A G 18: 67,820,355 Y481C probably damaging Het
Cep250 A G 2: 155,979,151 E887G probably damaging Het
Clcn1 C A 6: 42,298,838 A298D probably damaging Het
Col11a1 A G 3: 114,185,599 N1305S unknown Het
Depdc5 T C 5: 32,967,745 V1155A probably benign Het
Dnah1 A T 14: 31,269,894 D3050E probably benign Het
Dnah7a T C 1: 53,518,814 D2147G probably benign Het
Fbxl4 T C 4: 22,386,145 Y251H possibly damaging Het
Gm19410 A G 8: 35,785,766 M622V probably benign Het
Gm3402 T A 5: 146,514,662 M110K probably damaging Het
Gm4778 C T 3: 94,265,738 H14Y possibly damaging Het
Gm8257 T A 14: 44,656,360 E82D probably damaging Het
Gne T A 4: 44,042,175 I498F probably damaging Het
Gstcd C T 3: 133,084,779 V76I probably benign Het
Hgs G T 11: 120,474,313 V176L probably benign Het
Igbp1b T C 6: 138,658,110 N112S possibly damaging Het
Itga11 A T 9: 62,745,908 T355S probably benign Het
Lama1 A T 17: 67,743,297 H301L Het
Lhx9 T C 1: 138,832,751 D296G probably damaging Het
Lrp1 C T 10: 127,592,093 G537D probably damaging Het
Mrps36 A G 13: 100,739,199 S36P probably benign Het
Olfr618 T A 7: 103,597,748 I144N probably damaging Het
Plcb4 A T 2: 135,965,080 N547I probably benign Het
Plch2 T A 4: 154,998,967 M505L probably damaging Het
Prg4 T A 1: 150,454,067 N154Y not run Het
Rev1 A T 1: 38,085,601 V420D probably damaging Het
Rin3 A G 12: 102,390,115 I972V probably benign Het
Rtel1 T C 2: 181,351,861 L775P not run Het
Scarf2 G T 16: 17,803,290 C274F possibly damaging Het
Serinc2 C T 4: 130,258,259 V271I probably benign Het
Slpi C A 2: 164,356,402 probably benign Het
Stxbp6 T C 12: 44,901,999 D109G probably damaging Het
Tmem74 G A 15: 43,867,468 L60F probably benign Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trrap T C 5: 144,814,523 S1610P probably benign Het
Ttc33 C T 15: 5,217,237 Q175* probably null Het
Usp34 A G 11: 23,333,566 T106A probably benign Het
Vmn1r204 A G 13: 22,556,997 D266G probably benign Het
Wdfy3 C A 5: 101,855,523 A2905S probably benign Het
Wfs1 A G 5: 36,967,846 L567P probably damaging Het
Zfp42 T C 8: 43,296,275 E63G probably damaging Het
Zfp957 A G 14: 79,213,640 F240L probably damaging Het
Zgrf1 A T 3: 127,563,569 M815L probably benign Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 intron probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTGGCACACAAGGATGGAG -3'
(R):5'- AGGGACCTAAGGGAACTCTTTC -3'

Sequencing Primer
(F):5'- GCACACAAGGATGGAGTTTTTCC -3'
(R):5'- AACTCTTTCCTCTAGCCATTCTTTTC -3'
Posted On2019-06-26