Incidental Mutation 'R7265:Slc52a3'
ID564848
Institutional Source Beutler Lab
Gene Symbol Slc52a3
Ensembl Gene ENSMUSG00000027463
Gene Namesolute carrier protein family 52, member 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location151996511-152009258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152004416 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 99 (I99K)
Ref Sequence ENSEMBL: ENSMUSP00000072961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073228] [ENSMUST00000109858] [ENSMUST00000109859] [ENSMUST00000109861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073228
AA Change: I99K

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072961
Gene: ENSMUSG00000027463
AA Change: I99K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 210 232 N/A INTRINSIC
Pfam:DUF1011 285 386 7.6e-47 PFAM
transmembrane domain 390 412 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109858
AA Change: I99K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105484
Gene: ENSMUSG00000027463
AA Change: I99K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109859
AA Change: I99K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105485
Gene: ENSMUSG00000027463
AA Change: I99K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109861
AA Change: I99K

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105487
Gene: ENSMUSG00000027463
AA Change: I99K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 210 232 N/A INTRINSIC
Pfam:DUF1011 288 386 1.1e-42 PFAM
transmembrane domain 390 412 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a riboflavin transporter protein that is strongly expressed in the intestine and likely plays a role in intestinal absorption of riboflavin. The protein is predicted to have eleven transmembrane domains and a cell surface localization signal in the C-terminus. Mutations at this locus have been associated with Brown-Vialetto-Van Laere syndrome and Fazio-Londe disease. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal placental riboflavin transport and sudden neonatal death associated with hyperlipidemia and hypoglycemia due to riboflavin deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Slc52a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Slc52a3 APN 2 152007602 missense probably benign 0.41
IGL01511:Slc52a3 APN 2 152004644 missense probably benign 0.00
IGL02058:Slc52a3 APN 2 152005891 missense probably damaging 1.00
IGL02271:Slc52a3 APN 2 152005528 splice site probably benign
R0238:Slc52a3 UTSW 2 152008156 makesense probably null
R0238:Slc52a3 UTSW 2 152008156 makesense probably null
R0239:Slc52a3 UTSW 2 152008156 makesense probably null
R0239:Slc52a3 UTSW 2 152008156 makesense probably null
R0352:Slc52a3 UTSW 2 152007513 nonsense probably null
R3727:Slc52a3 UTSW 2 152005781 missense probably benign 0.00
R4272:Slc52a3 UTSW 2 152005740 missense possibly damaging 0.87
R4273:Slc52a3 UTSW 2 152005740 missense possibly damaging 0.87
R6267:Slc52a3 UTSW 2 152007609 splice site probably null
Predicted Primers PCR Primer
(F):5'- TACCTCACTGTGGTCATCCAG -3'
(R):5'- CATAGTGTTCAAGGTGGTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTGGCCAACATAGG -3'
(R):5'- TCTCCGTGACATTGACACAGGTG -3'
Posted On2019-06-26