Incidental Mutation 'R7265:Epb41'
ID564856
Institutional Source Beutler Lab
Gene Symbol Epb41
Ensembl Gene ENSMUSG00000028906
Gene Nameerythrocyte membrane protein band 4.1
SynonymsEpb4.1, 4.1R, D4Ertd442e, Elp1, Elp-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location131923413-132075321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131967834 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 14 (E14G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000105975] [ENSMUST00000105981] [ENSMUST00000137846] [ENSMUST00000141291]
Predicted Effect probably benign
Transcript: ENSMUST00000030739
AA Change: E594G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906
AA Change: E594G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054917
AA Change: E594G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906
AA Change: E594G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084253
AA Change: E594G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906
AA Change: E594G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105970
AA Change: E442G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906
AA Change: E442G

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105972
AA Change: E594G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906
AA Change: E594G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105974
AA Change: E559G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906
AA Change: E559G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105975
AA Change: E619G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906
AA Change: E619G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105981
AA Change: E594G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906
AA Change: E594G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135579
AA Change: E14G
SMART Domains Protein: ENSMUSP00000121764
Gene: ENSMUSG00000028906
AA Change: E14G

DomainStartEndE-ValueType
Pfam:SAB 28 76 2e-24 PFAM
low complexity region 148 159 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
Pfam:4_1_CTD 264 371 6.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137846
AA Change: E436G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906
AA Change: E436G

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141291
AA Change: E594G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120236
Gene: ENSMUSG00000028906
AA Change: E594G

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 647 695 1.3e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146443
AA Change: E4G
SMART Domains Protein: ENSMUSP00000122234
Gene: ENSMUSG00000028906
AA Change: E4G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
Pfam:SAB 53 101 7e-26 PFAM
Pfam:4_1_CTD 139 246 2.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212761
AA Change: E315G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit moderate hemolytic anemia, erythrocytic abnormalities including aberrant morphology, reduced membrane stability, and lowered expression of spectrin and ankyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Epb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Epb41 APN 4 131974731 missense probably benign
IGL00897:Epb41 APN 4 132000197 splice site probably null
IGL00911:Epb41 APN 4 131989784 missense possibly damaging 0.60
IGL01390:Epb41 APN 4 132003737 missense probably benign
IGL01459:Epb41 APN 4 131964128 intron probably benign
IGL01816:Epb41 APN 4 132003695 missense probably benign 0.00
IGL02192:Epb41 APN 4 131929717 missense probably damaging 0.99
IGL02296:Epb41 APN 4 132003754 missense probably benign 0.42
IGL03011:Epb41 APN 4 132003794 missense probably damaging 1.00
IGL03268:Epb41 APN 4 131928495 missense probably damaging 1.00
IGL03388:Epb41 APN 4 131974794 missense probably damaging 1.00
R0355:Epb41 UTSW 4 132000261 missense probably damaging 0.99
R0532:Epb41 UTSW 4 131978795 splice site probably benign
R0550:Epb41 UTSW 4 131975613 missense probably damaging 1.00
R0571:Epb41 UTSW 4 131989904 missense probably damaging 1.00
R1158:Epb41 UTSW 4 132000191 splice site probably benign
R1444:Epb41 UTSW 4 132006071 missense probably benign
R2106:Epb41 UTSW 4 131989841 missense probably damaging 1.00
R2269:Epb41 UTSW 4 131964147 missense probably benign 0.09
R4014:Epb41 UTSW 4 131982445 splice site probably benign
R4017:Epb41 UTSW 4 131982445 splice site probably benign
R4952:Epb41 UTSW 4 132000270 missense probably damaging 0.99
R4976:Epb41 UTSW 4 131937436 unclassified probably benign
R5058:Epb41 UTSW 4 132007435 utr 5 prime probably benign
R5119:Epb41 UTSW 4 131937436 unclassified probably benign
R5229:Epb41 UTSW 4 131978935 missense probably damaging 1.00
R5571:Epb41 UTSW 4 131937406 unclassified probably benign
R6250:Epb41 UTSW 4 131989873 missense probably damaging 1.00
R6531:Epb41 UTSW 4 131957636 missense probably benign 0.00
R6890:Epb41 UTSW 4 131935829 missense probably damaging 0.98
R7289:Epb41 UTSW 4 131991209 critical splice donor site probably null
R7322:Epb41 UTSW 4 131989719 missense probably damaging 0.99
X0066:Epb41 UTSW 4 131974740 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGTTGGTAAGAGATGACTTC -3'
(R):5'- TCACCCTGTGACTTTGAGGTC -3'

Sequencing Primer
(F):5'- TCTTTTAGAAACAATGAGAAAGGGC -3'
(R):5'- TAAGGAGAGTGACACCTGCCTTC -3'
Posted On2019-06-26