Incidental Mutation 'R7265:9330182L06Rik'
ID564859
Institutional Source Beutler Lab
Gene Symbol 9330182L06Rik
Ensembl Gene ENSMUSG00000056004
Gene NameRIKEN cDNA 9330182L06 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location9266118-9481825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9446975 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 813 (V813A)
Ref Sequence ENSEMBL: ENSMUSP00000069165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069538] [ENSMUST00000115348] [ENSMUST00000134991] [ENSMUST00000152095] [ENSMUST00000154662] [ENSMUST00000155764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069538
AA Change: V813A

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069165
Gene: ENSMUSG00000056004
AA Change: V813A

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 1.12e-7 PROSPERO
internal_repeat_1 343 665 1.12e-7 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115348
SMART Domains Protein: ENSMUSP00000111005
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134991
AA Change: V813A

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121757
Gene: ENSMUSG00000056004
AA Change: V813A

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 9.82e-8 PROSPERO
internal_repeat_1 343 665 9.82e-8 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152095
SMART Domains Protein: ENSMUSP00000116440
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154662
SMART Domains Protein: ENSMUSP00000116026
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155764
SMART Domains Protein: ENSMUSP00000120849
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 180 5.47e-6 PROSPERO
internal_repeat_1 343 476 5.47e-6 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in 9330182L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:9330182L06Rik APN 5 9422367 missense probably damaging 0.99
IGL00909:9330182L06Rik APN 5 9380282 missense probably damaging 1.00
IGL01477:9330182L06Rik APN 5 9437756 missense probably damaging 1.00
IGL02486:9330182L06Rik APN 5 9422323 missense probably benign 0.00
IGL02863:9330182L06Rik APN 5 9461399 nonsense probably null
IGL02939:9330182L06Rik APN 5 9461478 missense probably damaging 1.00
IGL03039:9330182L06Rik APN 5 9418055 missense probably benign 0.12
IGL03395:9330182L06Rik APN 5 9422359 missense probably damaging 0.97
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0193:9330182L06Rik UTSW 5 9422359 missense probably damaging 0.97
R0265:9330182L06Rik UTSW 5 9434681 missense probably damaging 1.00
R0398:9330182L06Rik UTSW 5 9445367 missense probably benign 0.00
R0432:9330182L06Rik UTSW 5 9440966 nonsense probably null
R0494:9330182L06Rik UTSW 5 9420723 critical splice donor site probably null
R0736:9330182L06Rik UTSW 5 9441745 missense probably damaging 1.00
R0850:9330182L06Rik UTSW 5 9417993 missense probably damaging 1.00
R1398:9330182L06Rik UTSW 5 9380297 missense probably damaging 1.00
R1709:9330182L06Rik UTSW 5 9440726 nonsense probably null
R1720:9330182L06Rik UTSW 5 9428407 missense probably damaging 1.00
R1770:9330182L06Rik UTSW 5 9418021 missense probably benign 0.01
R1782:9330182L06Rik UTSW 5 9421620 missense possibly damaging 0.62
R1803:9330182L06Rik UTSW 5 9427832 missense probably benign 0.05
R1868:9330182L06Rik UTSW 5 9479251 missense probably damaging 1.00
R1870:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1871:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1913:9330182L06Rik UTSW 5 9266275 missense probably damaging 0.97
R2054:9330182L06Rik UTSW 5 9463030 missense possibly damaging 0.81
R2170:9330182L06Rik UTSW 5 9479206 missense probably damaging 1.00
R2381:9330182L06Rik UTSW 5 9380342 missense probably damaging 1.00
R2396:9330182L06Rik UTSW 5 9435395 missense possibly damaging 0.92
R4003:9330182L06Rik UTSW 5 9440877 missense probably benign 0.05
R5030:9330182L06Rik UTSW 5 9428502 missense probably damaging 1.00
R5049:9330182L06Rik UTSW 5 9428488 missense probably damaging 1.00
R5069:9330182L06Rik UTSW 5 9440897 missense probably damaging 1.00
R5219:9330182L06Rik UTSW 5 9461486 missense probably damaging 1.00
R5400:9330182L06Rik UTSW 5 9479247 missense probably damaging 1.00
R5555:9330182L06Rik UTSW 5 9422296 splice site probably null
R5593:9330182L06Rik UTSW 5 9266350 missense probably benign 0.07
R5681:9330182L06Rik UTSW 5 9459308 critical splice donor site probably null
R5707:9330182L06Rik UTSW 5 9441698 missense probably damaging 1.00
R5756:9330182L06Rik UTSW 5 9462995 missense probably damaging 0.98
R6087:9330182L06Rik UTSW 5 9399255 missense probably damaging 1.00
R6252:9330182L06Rik UTSW 5 9410693 missense probably damaging 1.00
R7067:9330182L06Rik UTSW 5 9266295 missense possibly damaging 0.81
R7078:9330182L06Rik UTSW 5 9410709 missense probably benign 0.10
R7079:9330182L06Rik UTSW 5 9399253 missense probably damaging 1.00
R7117:9330182L06Rik UTSW 5 9445384 nonsense probably null
X0019:9330182L06Rik UTSW 5 9399231 missense probably damaging 0.97
X0052:9330182L06Rik UTSW 5 9440908 missense possibly damaging 0.87
X0063:9330182L06Rik UTSW 5 9399239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACTCTTATCTGGAATGGCTCAG -3'
(R):5'- AAGCTGTCATGCTAGGCAC -3'

Sequencing Primer
(F):5'- GGAATGGCTCAGTTTAATATTTCTGG -3'
(R):5'- TGTCATGCTAGGCACCCTGAAG -3'
Posted On2019-06-26