Incidental Mutation 'R7265:Coq2'
ID564864
Institutional Source Beutler Lab
Gene Symbol Coq2
Ensembl Gene ENSMUSG00000029319
Gene Namecoenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Synonyms2310002F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location100654723-100675140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100660270 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 222 (S222P)
Ref Sequence ENSEMBL: ENSMUSP00000031262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031262] [ENSMUST00000126981] [ENSMUST00000127811] [ENSMUST00000135801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031262
AA Change: S222P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031262
Gene: ENSMUSG00000029319
AA Change: S222P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 55 67 N/A INTRINSIC
Pfam:UbiA 89 348 2.1e-52 PFAM
low complexity region 354 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126981
SMART Domains Protein: ENSMUSP00000122296
Gene: ENSMUSG00000029319

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 55 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127811
Predicted Effect probably benign
Transcript: ENSMUST00000135146
SMART Domains Protein: ENSMUSP00000122631
Gene: ENSMUSG00000029319

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135801
AA Change: S39P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119410
Gene: ENSMUSG00000029319
AA Change: S39P

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that functions in the final steps in the biosynthesis of CoQ (ubiquinone), a redox carrier in the mitochondrial respiratory chain and a lipid-soluble antioxidant. This enzyme, which is part of the coenzyme Q10 pathway, catalyzes the prenylation of parahydroxybenzoate with an all-trans polyprenyl group. Mutations in this gene cause coenzyme Q10 deficiency, a mitochondrial encephalomyopathy, and also COQ2 nephropathy, an inherited form of mitochondriopathy with primary renal involvement. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Coq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Coq2 APN 5 100655314 missense probably benign 0.00
IGL02987:Coq2 APN 5 100663688 nonsense probably null
R0051:Coq2 UTSW 5 100663685 missense probably benign 0.00
R0051:Coq2 UTSW 5 100663685 missense probably benign 0.00
R0538:Coq2 UTSW 5 100668023 missense possibly damaging 0.89
R1056:Coq2 UTSW 5 100657947 missense probably benign 0.01
R1934:Coq2 UTSW 5 100661865 missense probably damaging 1.00
R4788:Coq2 UTSW 5 100657909 missense probably damaging 0.96
R5071:Coq2 UTSW 5 100667950 missense probably damaging 1.00
R5221:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R5232:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R5233:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R6301:Coq2 UTSW 5 100661863 missense possibly damaging 0.90
R6450:Coq2 UTSW 5 100661904 utr 3 prime probably benign
R7096:Coq2 UTSW 5 100663720 utr 5 prime probably benign
R7453:Coq2 UTSW 5 100663586 missense probably benign 0.01
R7530:Coq2 UTSW 5 100674142 missense not run
Predicted Primers PCR Primer
(F):5'- AGCCTGCATTTTAACCTGGTC -3'
(R):5'- CCACAAGAGATTGAGAAGATCCTG -3'

Sequencing Primer
(F):5'- ACTTGGCCTCACAGTAAGTTTCAGG -3'
(R):5'- TCCTGTGAGGGAAGGACAGAC -3'
Posted On2019-06-26