Incidental Mutation 'R7265:Umod'
ID564874
Institutional Source Beutler Lab
Gene Symbol Umod
Ensembl Gene ENSMUSG00000030963
Gene Nameuromodulin
Synonymsuromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119462711-119479282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119466073 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 578 (Q578K)
Ref Sequence ENSEMBL: ENSMUSP00000146652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000209095]
Predicted Effect probably benign
Transcript: ENSMUST00000033263
AA Change: Q578K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: Q578K

DomainStartEndE-ValueType
EGF 31 64 4.03e-1 SMART
EGF_CA 65 106 3.81e-11 SMART
EGF_CA 107 155 4.81e-8 SMART
Blast:ZP 256 325 6e-30 BLAST
ZP 335 586 2.19e-70 SMART
low complexity region 619 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208401
Predicted Effect probably benign
Transcript: ENSMUST00000209095
AA Change: Q578K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1352 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Olfr888 A T 9: 38,108,931 I77L possibly damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Umod
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Umod APN 7 119477219 missense possibly damaging 0.93
IGL02527:Umod APN 7 119469467 missense probably damaging 1.00
R0265:Umod UTSW 7 119466073 missense probably benign 0.00
R1073:Umod UTSW 7 119464741 missense possibly damaging 0.56
R1117:Umod UTSW 7 119477306 missense possibly damaging 0.71
R1515:Umod UTSW 7 119465497 missense probably benign 0.00
R1774:Umod UTSW 7 119477351 missense possibly damaging 0.82
R1803:Umod UTSW 7 119464724 missense probably damaging 0.96
R1864:Umod UTSW 7 119463255 missense probably damaging 0.99
R1942:Umod UTSW 7 119476932 missense probably damaging 1.00
R2060:Umod UTSW 7 119476715 missense probably damaging 0.97
R2354:Umod UTSW 7 119466193 missense probably damaging 1.00
R3015:Umod UTSW 7 119472540 missense probably damaging 1.00
R3030:Umod UTSW 7 119476839 missense probably benign 0.02
R4016:Umod UTSW 7 119476690 missense possibly damaging 0.56
R4406:Umod UTSW 7 119466064 missense probably damaging 1.00
R4446:Umod UTSW 7 119466056 splice site probably null
R5062:Umod UTSW 7 119472421 nonsense probably null
R5358:Umod UTSW 7 119472354 missense probably damaging 1.00
R5935:Umod UTSW 7 119471427 missense probably damaging 1.00
R6045:Umod UTSW 7 119476823 missense probably benign
R6239:Umod UTSW 7 119477297 missense probably damaging 1.00
R7111:Umod UTSW 7 119477146 nonsense probably null
R7168:Umod UTSW 7 119478326 splice site probably benign
R7273:Umod UTSW 7 119477027 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGACCATGTGTCCTGACTGG -3'
(R):5'- TTCCAACTCTGTGGTTGAAGAC -3'

Sequencing Primer
(F):5'- ATGTGTCCTGACTGGCCCTAC -3'
(R):5'- AATGGGCTGTTCCAAGTCAC -3'
Posted On2019-06-26