Incidental Mutation 'R7265:Olfr888'
ID564877
Institutional Source Beutler Lab
Gene Symbol Olfr888
Ensembl Gene ENSMUSG00000095527
Gene Nameolfactory receptor 888
SynonymsGA_x6K02T2PVTD-31787920-31788864, MOR162-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7265 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38108128-38111381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38108931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 77 (I77L)
Ref Sequence ENSEMBL: ENSMUSP00000148476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075228] [ENSMUST00000211851]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075228
AA Change: I82L

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074713
Gene: ENSMUSG00000095527
AA Change: I82L

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 8.8e-49 PFAM
Pfam:7tm_1 46 293 3.9e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211851
AA Change: I77L

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
9330182L06Rik T C 5: 9,446,975 V813A possibly damaging Het
Asb3 A G 11: 30,998,495 E57G probably benign Het
B3glct A G 5: 149,709,320 D45G probably benign Het
BC034090 C A 1: 155,225,327 C397F probably damaging Het
Bicd1 A G 6: 149,513,876 K696E probably damaging Het
Btnl4 C T 17: 34,475,894 C15Y probably benign Het
Cabin1 T C 10: 75,721,423 N300S Het
Chia1 T A 3: 106,128,923 L273Q probably damaging Het
Coq2 A G 5: 100,660,270 S222P possibly damaging Het
Dgkb T C 12: 38,184,932 V432A possibly damaging Het
Dpp3 A G 19: 4,923,769 F92S probably damaging Het
Emcn T C 3: 137,417,078 S183P probably damaging Het
Emcn T A 3: 137,419,076 W217R probably damaging Het
Enpp2 A C 15: 54,910,033 probably null Het
Epb41 T C 4: 131,967,834 E14G unknown Het
Fam160a2 G T 7: 105,384,225 R609S probably benign Het
Grk4 A G 5: 34,716,264 R225G probably damaging Het
Insl6 A T 19: 29,321,545 W156R possibly damaging Het
Ints3 A T 3: 90,403,983 probably null Het
Jarid2 G A 13: 44,902,272 G318D probably benign Het
Kif16b A T 2: 142,714,730 L596H probably damaging Het
Lctl T A 9: 64,126,921 Y281N probably damaging Het
Letm1 A T 5: 33,778,648 C34S possibly damaging Het
Lrrc32 T C 7: 98,499,437 S475P probably damaging Het
Lrrc37a T A 11: 103,498,941 D1886V probably benign Het
Macf1 A T 4: 123,407,877 I944K probably benign Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mecom C A 3: 29,980,133 A465S possibly damaging Het
Muc16 A G 9: 18,656,472 S1584P unknown Het
Mycbp2 A G 14: 103,197,243 probably null Het
Myo18b G A 5: 112,812,072 R1372W probably damaging Het
Myo1c T C 11: 75,669,790 I706T possibly damaging Het
Myo1g T C 11: 6,510,933 T704A possibly damaging Het
Nwd1 A G 8: 72,692,928 K914E probably benign Het
Olfr1056 C T 2: 86,355,744 V213I probably benign Het
Olfr202 T A 16: 59,283,924 D191V probably damaging Het
Otub2 C T 12: 103,400,221 S99L probably damaging Het
Pak7 G A 2: 136,101,185 S345L probably benign Het
Pcdhb20 A T 18: 37,505,563 I381F possibly damaging Het
Pcdhga7 A G 18: 37,716,916 T659A probably damaging Het
Pik3c2a T A 7: 116,388,086 K533N probably damaging Het
Pkd1l1 T A 11: 8,929,402 Q933L Het
Ppp4r3a A T 12: 101,053,511 M395K possibly damaging Het
Pramef6 C A 4: 143,895,421 V455L probably benign Het
Ptpn20 A G 14: 33,614,524 T107A probably benign Het
Scaf8 T A 17: 3,177,625 D376E unknown Het
Scn11a C A 9: 119,815,265 C143F probably damaging Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Sec13 A T 6: 113,735,136 Y79* probably null Het
Sez6 T A 11: 77,962,865 I287N probably damaging Het
Slc52a3 T A 2: 152,004,416 I99K possibly damaging Het
Slco4c1 T G 1: 96,871,793 H106P probably damaging Het
Tada2b A G 5: 36,476,608 Y209H probably damaging Het
Tas1r2 T A 4: 139,669,652 D796E probably benign Het
Tdrd12 A T 7: 35,487,722 M581K Het
Thnsl1 A G 2: 21,212,458 E341G probably damaging Het
Tlk2 C T 11: 105,184,244 R11* probably null Het
Tmco6 T C 18: 36,739,343 probably null Het
Trmt44 A T 5: 35,564,303 H505Q probably benign Het
Trpc1 T C 9: 95,708,275 M710V probably benign Het
Ttc21b T C 2: 66,210,173 E858G possibly damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Vmn2r6 T C 3: 64,556,774 N213S probably benign Het
Vmn2r88 G A 14: 51,418,319 V662I Het
Zfp414 C A 17: 33,631,279 D217E probably benign Het
Other mutations in Olfr888
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Olfr888 APN 9 38109562 missense probably damaging 1.00
IGL02158:Olfr888 APN 9 38109129 missense probably benign 0.09
IGL02713:Olfr888 APN 9 38109327 missense probably damaging 0.99
R0007:Olfr888 UTSW 9 38109094 missense possibly damaging 0.94
R0125:Olfr888 UTSW 9 38109519 missense probably benign 0.03
R0310:Olfr888 UTSW 9 38109486 missense possibly damaging 0.54
R1671:Olfr888 UTSW 9 38109132 missense probably benign
R3687:Olfr888 UTSW 9 38108881 missense probably damaging 1.00
R3704:Olfr888 UTSW 9 38109003 missense possibly damaging 0.95
R3708:Olfr888 UTSW 9 38109444 missense probably damaging 0.99
R3824:Olfr888 UTSW 9 38108838 missense possibly damaging 0.71
R3825:Olfr888 UTSW 9 38108838 missense possibly damaging 0.71
R4254:Olfr888 UTSW 9 38109250 missense probably damaging 1.00
R4828:Olfr888 UTSW 9 38108740 missense probably damaging 0.98
Z1088:Olfr888 UTSW 9 38109586 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTTCAGCAATGACTCTTC -3'
(R):5'- TGGTAACCTGGTAAAGCAGG -3'

Sequencing Primer
(F):5'- CAGCAATGACTCTTCTGTGAAGG -3'
(R):5'- GGGCTTACAGATGGCAGCATATC -3'
Posted On2019-06-26