Incidental Mutation 'R7266:Trim56'
ID564922
Institutional Source Beutler Lab
Gene Symbol Trim56
Ensembl Gene ENSMUSG00000043279
Gene Nametripartite motif-containing 56
SynonymsRNF109, A130009K11Rik, LOC384309
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7266 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137105644-137116209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 137114243 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 140 (Q140K)
Ref Sequence ENSEMBL: ENSMUSP00000058109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054384] [ENSMUST00000152207]
Predicted Effect probably damaging
Transcript: ENSMUST00000054384
AA Change: Q140K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058109
Gene: ENSMUSG00000043279
AA Change: Q140K

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 1.9e-7 PFAM
coiled coil region 257 291 N/A INTRINSIC
low complexity region 302 309 N/A INTRINSIC
low complexity region 381 399 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152207
AA Change: Q140K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117874
Gene: ENSMUSG00000043279
AA Change: Q140K

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 2.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 24,667,623 I104F probably benign Het
Adgrg7 C T 16: 56,770,311 V166I probably benign Het
Agfg1 G T 1: 82,882,245 V278L probably benign Het
Alpk3 A G 7: 81,092,580 E715G possibly damaging Het
Ap2m1 A G 16: 20,543,345 Y401C probably damaging Het
Arhgef28 C T 13: 97,965,452 S838N probably benign Het
Ash2l A T 8: 25,827,205 Y373* probably null Het
Best2 C T 8: 85,007,764 V442I probably benign Het
Col4a2 T C 8: 11,425,542 probably null Het
Fat2 T A 11: 55,285,030 D1619V probably damaging Het
Fer1l6 A T 15: 58,627,597 N1272I probably benign Het
Gcc1 T A 6: 28,417,996 *779C probably null Het
Gm12216 G A 11: 53,859,251 probably benign Het
Gm17657 C A 17: 29,519,373 V140L probably benign Het
Gm7102 A G 19: 61,175,535 V154A possibly damaging Het
Grm2 C T 9: 106,647,171 V311I Het
Immt T A 6: 71,874,705 D683E probably benign Het
Itga8 T G 2: 12,232,901 D336A probably damaging Het
Jhy T C 9: 40,961,157 T19A probably benign Het
Kcnq2 T C 2: 181,135,092 M1V probably null Het
Kctd17 A T 15: 78,433,014 I117F probably damaging Het
Lrp6 T C 6: 134,507,401 T420A probably damaging Het
Manba T C 3: 135,517,912 S187P probably damaging Het
Mef2b A T 8: 70,164,288 D13V probably damaging Het
Mical2 T C 7: 112,303,756 F145L probably damaging Het
Mphosph8 T A 14: 56,685,040 D551E possibly damaging Het
Myo10 C G 15: 25,782,981 R1170G probably damaging Het
Myo16 A C 8: 10,272,687 Q39P unknown Het
Myo1f A G 17: 33,601,694 E837G probably benign Het
Nell2 T A 15: 95,435,393 I128F possibly damaging Het
Olfr1357 A G 10: 78,612,614 V9A probably benign Het
Pcdh15 A T 10: 74,379,390 R659* probably null Het
Pcdhga1 A G 18: 37,839,975 Q881R possibly damaging Het
Plekhm2 T G 4: 141,642,459 E75A possibly damaging Het
Prc1 A G 7: 80,307,657 K357E possibly damaging Het
Pxk T A 14: 8,146,220 C377S probably benign Het
Ralgapa2 T C 2: 146,334,568 E1696G probably damaging Het
Rbbp6 T A 7: 123,001,367 S1532R unknown Het
Scn5a G T 9: 119,562,560 A22E probably benign Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Siae T C 9: 37,623,013 V115A probably damaging Het
Slc16a6 A G 11: 109,453,281 C563R probably benign Het
Sntg1 A C 1: 8,682,019 V58G possibly damaging Het
Snx11 C T 11: 96,773,159 V36M probably damaging Het
Stk3 C A 15: 34,959,036 S330I probably benign Het
Synpo A G 18: 60,629,559 F92S probably benign Het
Tle1 A G 4: 72,139,687 probably null Het
Tmem117 A G 15: 94,931,803 D173G possibly damaging Het
Tmprss5 T C 9: 49,114,541 W338R probably benign Het
Tnfrsf19 T C 14: 60,974,698 T168A possibly damaging Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Ttn C T 2: 76,732,574 V28679M probably damaging Het
Ubxn8 G A 8: 33,623,203 R208C probably damaging Het
Vmn2r72 G T 7: 85,738,274 S694* probably null Het
Wdr38 T A 2: 39,000,264 W137R probably damaging Het
Zdhhc6 G T 19: 55,304,500 N271K probably damaging Het
Zfyve9 A G 4: 108,718,547 S446P possibly damaging Het
Zmynd8 T C 2: 165,807,572 Q867R possibly damaging Het
Zswim3 T C 2: 164,820,482 I294T probably benign Het
Other mutations in Trim56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Trim56 APN 5 137114500 missense possibly damaging 0.95
IGL02604:Trim56 APN 5 137113076 missense probably damaging 0.98
IGL02653:Trim56 APN 5 137112906 missense probably damaging 1.00
IGL03069:Trim56 APN 5 137113762 missense probably damaging 0.99
R0711:Trim56 UTSW 5 137112992 missense probably benign 0.00
R1167:Trim56 UTSW 5 137112520 missense probably damaging 0.98
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1508:Trim56 UTSW 5 137113937 missense probably benign 0.00
R1791:Trim56 UTSW 5 137114398 missense probably damaging 1.00
R2484:Trim56 UTSW 5 137112674 missense possibly damaging 0.95
R4274:Trim56 UTSW 5 137113687 missense probably damaging 1.00
R4579:Trim56 UTSW 5 137114064 missense possibly damaging 0.60
R4766:Trim56 UTSW 5 137112725 missense probably benign 0.07
R4932:Trim56 UTSW 5 137114489 missense probably damaging 1.00
R5117:Trim56 UTSW 5 137113978 missense probably benign 0.13
R6444:Trim56 UTSW 5 137112616 missense probably damaging 0.99
R6747:Trim56 UTSW 5 137114521 missense probably damaging 1.00
R6962:Trim56 UTSW 5 137112647 missense probably damaging 0.97
R7115:Trim56 UTSW 5 137113660 missense probably damaging 0.98
X0019:Trim56 UTSW 5 137114210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAACTCCTCAAGGCCTGGC -3'
(R):5'- TCTTGTCAAGGCCAGAGCTC -3'

Sequencing Primer
(F):5'- AACGCACTGCTTCCGCTAG -3'
(R):5'- CCAGAGCTCCCGGAGAC -3'
Posted On2019-06-26