Incidental Mutation 'R7267:Vav2'
ID564970
Institutional Source Beutler Lab
Gene Symbol Vav2
Ensembl Gene ENSMUSG00000009621
Gene Namevav 2 oncogene
Synonyms2810040F13Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location27262104-27427033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27283322 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 497 (F497L)
Ref Sequence ENSEMBL: ENSMUSP00000062782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056176] [ENSMUST00000185188]
Predicted Effect probably damaging
Transcript: ENSMUST00000056176
AA Change: F497L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062782
Gene: ENSMUSG00000009621
AA Change: F497L

DomainStartEndE-ValueType
CH 3 115 1.87e-24 SMART
low complexity region 165 176 N/A INTRINSIC
RhoGEF 197 370 2.41e-57 SMART
PH 401 504 2.05e-10 SMART
C1 514 562 1.43e-11 SMART
SH3 579 641 1.26e-13 SMART
SH2 661 743 3.37e-25 SMART
low complexity region 759 777 N/A INTRINSIC
SH3 809 866 3.27e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185188
AA Change: F468L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138964
Gene: ENSMUSG00000009621
AA Change: F468L

DomainStartEndE-ValueType
CH 3 129 3.71e-2 SMART
RhoGEF 163 336 2.41e-57 SMART
PH 367 475 1.78e-10 SMART
C1 485 533 1.43e-11 SMART
SH3 550 612 1.26e-13 SMART
SH2 632 714 1.26e-15 SMART
low complexity region 771 789 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Vav family of Rho guanine nucleotide exchange factors. Vav family proteins are involved in the development and activation of lymphocytes, and the encoded protein may also be involved in angiogenesis. Disruption of this gene in mice is associated with heart, artery, and kidney defects, as well as tachycardia and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have defects in humoral immune response to type II thymus-independent antigens, in primary response to thymus-dependent antigens and inability to switch immunoglobulin class, form germinal centers and generate secondary responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Vav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Vav2 APN 2 27277238 missense probably benign 0.35
IGL02394:Vav2 APN 2 27297659 splice site probably benign
IGL03088:Vav2 APN 2 27267250 missense possibly damaging 0.74
IGL03256:Vav2 APN 2 27271900 splice site probably null
IGL03295:Vav2 APN 2 27275029 missense possibly damaging 0.90
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0140:Vav2 UTSW 2 27273676 splice site probably benign
R0331:Vav2 UTSW 2 27296175 missense probably benign 0.09
R0619:Vav2 UTSW 2 27296121 critical splice donor site probably null
R1191:Vav2 UTSW 2 27292780 splice site probably null
R1723:Vav2 UTSW 2 27318964 missense possibly damaging 0.94
R2107:Vav2 UTSW 2 27267303 missense probably damaging 1.00
R2131:Vav2 UTSW 2 27299396 missense possibly damaging 0.71
R2164:Vav2 UTSW 2 27273706 missense probably damaging 0.96
R2268:Vav2 UTSW 2 27292655 splice site probably null
R2927:Vav2 UTSW 2 27426391 missense probably damaging 1.00
R3802:Vav2 UTSW 2 27267223 splice site probably benign
R4050:Vav2 UTSW 2 27288679 missense probably benign 0.01
R4050:Vav2 UTSW 2 27291403 missense probably damaging 1.00
R4626:Vav2 UTSW 2 27270160 missense possibly damaging 0.62
R4895:Vav2 UTSW 2 27318961 missense probably damaging 0.99
R5441:Vav2 UTSW 2 27270110 intron probably benign
R6009:Vav2 UTSW 2 27271900 splice site probably null
R6501:Vav2 UTSW 2 27296219 missense probably damaging 1.00
R6564:Vav2 UTSW 2 27279185 splice site probably null
R7206:Vav2 UTSW 2 27336719 missense probably benign 0.17
X0064:Vav2 UTSW 2 27282351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCACTTCCTAGACTTC -3'
(R):5'- GTCACACAAGACGTAGGCAC -3'

Sequencing Primer
(F):5'- GGCACTTCCTAGACTTCCAAGC -3'
(R):5'- GAACTTGTGTGCACCTGATAGCATC -3'
Posted On2019-06-26