Incidental Mutation 'R7267:Camk2d'
ID564979
Institutional Source Beutler Lab
Gene Symbol Camk2d
Ensembl Gene ENSMUSG00000053819
Gene Namecalcium/calmodulin-dependent protein kinase II, delta
SynonymsCaMK II, 2810011D23Rik, 8030469K03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location126596302-126846326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126797730 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 283 (H283L)
Ref Sequence ENSEMBL: ENSMUSP00000102010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066466] [ENSMUST00000106399] [ENSMUST00000106400] [ENSMUST00000106401] [ENSMUST00000106402] [ENSMUST00000134466] [ENSMUST00000145454] [ENSMUST00000163226] [ENSMUST00000171289] [ENSMUST00000199300] [ENSMUST00000200171]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066466
AA Change: H283L

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063359
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 7.4e-67 PFAM
Pfam:DUF4440 350 464 4.7e-13 PFAM
Pfam:SnoaL_3 350 476 3e-12 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000102007
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 357 484 3.5e-67 PFAM
Pfam:DUF4440 361 475 5.4e-13 PFAM
Pfam:SnoaL_3 361 487 3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106400
AA Change: H283L

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102008
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 4.7e-67 PFAM
Pfam:DUF4440 350 464 3.2e-13 PFAM
Pfam:SnoaL_3 350 476 2.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106401
AA Change: H283L

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102009
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.8e-67 PFAM
Pfam:DUF4440 384 498 5.8e-13 PFAM
Pfam:SnoaL_3 384 510 3.2e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106402
AA Change: H283L

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102010
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 1.1e-66 PFAM
Pfam:DUF4440 384 498 8.1e-13 PFAM
Pfam:SnoaL_3 384 510 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134466
SMART Domains Protein: ENSMUSP00000114801
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1e-33 PFAM
Pfam:Pkinase_Tyr 14 141 4.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145454
SMART Domains Protein: ENSMUSP00000130769
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1.4e-33 PFAM
Pfam:Pkinase_Tyr 14 142 4.7e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163226
AA Change: H283L

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133019
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171289
AA Change: H283L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129999
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.3e-63 PFAM
Pfam:DUF4440 384 498 3.2e-12 PFAM
Pfam:SnoaL_3 384 509 8.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199300
AA Change: H283L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143504
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 1.3e-62 PFAM
Pfam:DUF4440 350 464 1.7e-11 PFAM
Pfam:SnoaL_3 350 475 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200171
AA Change: H283L

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143677
Gene: ENSMUSG00000053819
AA Change: H283L

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 9.8e-63 PFAM
Pfam:DUF4440 384 498 2.5e-11 PFAM
Pfam:SnoaL_3 384 509 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced response to heart induced stress. Mice homozygous for an allele that produces an oxidant-resistant product exhibit reduced response to myocardial infarction in a diabetic model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Camk2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Camk2d APN 3 126838272 nonsense probably null
IGL01113:Camk2d APN 3 126780412 missense probably damaging 1.00
IGL01125:Camk2d APN 3 126798285 splice site probably benign
IGL01912:Camk2d APN 3 126810632 splice site probably null
IGL01934:Camk2d APN 3 126834655 splice site probably null
IGL02184:Camk2d APN 3 126797773 missense probably damaging 0.97
IGL02218:Camk2d APN 3 126840153 missense probably benign 0.00
IGL02804:Camk2d APN 3 126797738 missense possibly damaging 0.53
IGL03347:Camk2d APN 3 126796901 missense probably damaging 1.00
IGL03354:Camk2d APN 3 126796966 splice site probably null
baryon UTSW 3 126597482 nonsense probably null
neutron UTSW 3 126780420 missense probably damaging 1.00
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0628:Camk2d UTSW 3 126810624 splice site probably benign
R1114:Camk2d UTSW 3 126840292 missense probably damaging 1.00
R1433:Camk2d UTSW 3 126808224 missense probably benign 0.25
R2021:Camk2d UTSW 3 126780456 missense probably damaging 1.00
R2096:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2098:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2421:Camk2d UTSW 3 126780415 missense probably damaging 1.00
R2437:Camk2d UTSW 3 126834628 missense probably damaging 1.00
R2930:Camk2d UTSW 3 126808231 missense possibly damaging 0.86
R3738:Camk2d UTSW 3 126771839 missense probably damaging 1.00
R3969:Camk2d UTSW 3 126796959 missense possibly damaging 0.81
R4455:Camk2d UTSW 3 126780403 missense probably damaging 1.00
R4829:Camk2d UTSW 3 126779997 intron probably benign
R4916:Camk2d UTSW 3 126783975 missense probably damaging 1.00
R5277:Camk2d UTSW 3 126684741 intron probably benign
R5329:Camk2d UTSW 3 126597482 nonsense probably null
R5364:Camk2d UTSW 3 126780420 missense probably damaging 1.00
R5473:Camk2d UTSW 3 126597399 utr 5 prime probably benign
R5509:Camk2d UTSW 3 126840316 missense probably damaging 1.00
R5958:Camk2d UTSW 3 126779865 intron probably benign
R6010:Camk2d UTSW 3 126797714 missense possibly damaging 0.83
R6145:Camk2d UTSW 3 126805858 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTTTAAGCTCAGTCACTAGC -3'
(R):5'- GGCTTGATTATGGAGCATGCTC -3'

Sequencing Primer
(F):5'- CACTAGCAATCTTTATAAAACCATGC -3'
(R):5'- CTCGGATCCAGGACTGACTACTG -3'
Posted On2019-06-26