Incidental Mutation 'R7267:Mobp'
ID565007
Institutional Source Beutler Lab
Gene Symbol Mobp
Ensembl Gene ENSMUSG00000032517
Gene Namemyelin-associated oligodendrocytic basic protein
SynonymsMOBP155
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location120149707-120181484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120167848 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 15 (N15S)
Ref Sequence ENSEMBL: ENSMUSP00000071084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068698] [ENSMUST00000093773] [ENSMUST00000111627] [ENSMUST00000174193] [ENSMUST00000214943] [ENSMUST00000215512]
Predicted Effect probably damaging
Transcript: ENSMUST00000068698
AA Change: N15S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071084
Gene: ENSMUSG00000032517
AA Change: N15S

DomainStartEndE-ValueType
Pfam:FYVE_2 1 75 6.4e-13 PFAM
low complexity region 82 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093773
AA Change: N15S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091287
Gene: ENSMUSG00000032517
AA Change: N15S

DomainStartEndE-ValueType
Pfam:FYVE_2 1 77 3.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111627
AA Change: N15S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107254
Gene: ENSMUSG00000032517
AA Change: N15S

DomainStartEndE-ValueType
Pfam:FYVE_2 1 77 3.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174193
AA Change: N15S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134410
Gene: ENSMUSG00000032517
AA Change: N15S

DomainStartEndE-ValueType
Pfam:FYVE_2 1 77 3.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214943
AA Change: N15S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215512
AA Change: N15S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele show abnormal myelin arrangements but do not exhibit an overt behavorial phenotype. Mice homozygous for another allele have normal myelin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Mobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Mobp APN 9 120168234 missense probably benign 0.08
IGL01730:Mobp APN 9 120167926 missense probably damaging 1.00
IGL02078:Mobp APN 9 120167914 missense probably damaging 1.00
IGL02470:Mobp APN 9 120168006 missense probably benign 0.18
P0041:Mobp UTSW 9 120168017 utr 3 prime probably benign
R3794:Mobp UTSW 9 120167967 nonsense probably null
R3890:Mobp UTSW 9 120167956 missense probably damaging 1.00
R5173:Mobp UTSW 9 120168245 missense possibly damaging 0.68
R5255:Mobp UTSW 9 120168353 unclassified probably benign
R5549:Mobp UTSW 9 120167810 missense probably damaging 1.00
R5870:Mobp UTSW 9 120167853 missense probably damaging 0.98
R6128:Mobp UTSW 9 120168326 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAGCTCTGCACCTTTG -3'
(R):5'- TCCTAACAGGGAGCTGACAG -3'

Sequencing Primer
(F):5'- GCACCTTTGTTCTGCAGAGC -3'
(R):5'- AATGTGGTGTAGACCTGGCCC -3'
Posted On2019-06-26