Incidental Mutation 'R7267:Mars'
ID565011
Institutional Source Beutler Lab
Gene Symbol Mars
Ensembl Gene ENSMUSG00000040354
Gene Namemethionine-tRNA synthetase
Synonymsmethionine tRNA ligase, MetRS, methionyl-tRNA synthetase
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127296221-127311786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127308586 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 195 (V195A)
Ref Sequence ENSEMBL: ENSMUSP00000037446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037290] [ENSMUST00000171564]
Predicted Effect probably benign
Transcript: ENSMUST00000037290
AA Change: V195A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037446
Gene: ENSMUSG00000040354
AA Change: V195A

DomainStartEndE-ValueType
PDB:4BL7|A 1 220 1e-118 PDB
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 6.8e-142 PFAM
WHEP-TRS 847 902 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171564
AA Change: V195A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130666
Gene: ENSMUSG00000040354
AA Change: V195A

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:GST_C 94 180 1e-6 PFAM
low complexity region 205 213 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 9.6e-149 PFAM
WHEP-TRS 855 910 7.95e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: The encoded protein belongs to the class I family of tRNA synthetases, a class of enzymes that charge tRNAs with their cognate amino acids. The related human gene product is essential for the translation initiation of mRNAs. This gene has an overlapping 3' UTR tail-to-tail arrangement with an adjacent gene on the opposite strand that encodes an inhibitor of the CCAAT/enhancer-binding protein's DNA binding activity. This arrangement, conserved in human and mouse, may be involved in mRNA stability and possible functional and regulatory interaction of these adjacent overlapping genes. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Bmpr1a G A 14: 34,443,879 P57L possibly damaging Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Mars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Mars APN 10 127298006 missense probably benign 0.31
IGL00813:Mars APN 10 127300047 missense probably damaging 1.00
IGL01292:Mars APN 10 127305518 missense probably damaging 1.00
IGL01718:Mars APN 10 127305838 missense possibly damaging 0.95
IGL02505:Mars APN 10 127304244 nonsense probably null
IGL02986:Mars APN 10 127297569 missense probably benign 0.09
PIT4366001:Mars UTSW 10 127299398 missense possibly damaging 0.72
R0149:Mars UTSW 10 127300034 missense probably damaging 1.00
R1445:Mars UTSW 10 127297988 missense possibly damaging 0.75
R1702:Mars UTSW 10 127310079 missense possibly damaging 0.52
R1998:Mars UTSW 10 127300478 nonsense probably null
R1998:Mars UTSW 10 127302871 missense probably benign
R2089:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R4597:Mars UTSW 10 127300453 missense probably damaging 1.00
R4809:Mars UTSW 10 127300215 missense probably damaging 1.00
R4923:Mars UTSW 10 127296680 unclassified probably benign
R5563:Mars UTSW 10 127308661 missense probably benign
R5890:Mars UTSW 10 127298045 missense probably benign 0.04
R5895:Mars UTSW 10 127296549 missense probably benign 0.01
R5986:Mars UTSW 10 127304302 nonsense probably null
R6300:Mars UTSW 10 127296560 missense probably benign 0.00
X0027:Mars UTSW 10 127308349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGAAGGTGGCCACAATCAAC -3'
(R):5'- ATGACGGGGAAACTGTAGCC -3'

Sequencing Primer
(F):5'- GGTGGCCACAATCAACATCCG -3'
(R):5'- CGAATATGGCCAGGGTCAC -3'
Posted On2019-06-26