Incidental Mutation 'R7267:Bmpr1a'
ID565023
Institutional Source Beutler Lab
Gene Symbol Bmpr1a
Ensembl Gene ENSMUSG00000021796
Gene Namebone morphogenetic protein receptor, type 1A
SynonymsBMPR-IA, 1110037I22Rik, Bmpr, ALK3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7267 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34410734-34503341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34443879 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 57 (P57L)
Ref Sequence ENSEMBL: ENSMUSP00000035900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049005] [ENSMUST00000165280] [ENSMUST00000171343] [ENSMUST00000171551]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049005
AA Change: P57L

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035900
Gene: ENSMUSG00000021796
AA Change: P57L

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 4.6e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165280
AA Change: P57L

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131984
Gene: ENSMUSG00000021796
AA Change: P57L

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 1.3e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171343
AA Change: P57L

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126852
Gene: ENSMUSG00000021796
AA Change: P57L

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171551
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 9.5, are smaller than normal, and form no mesoderm; a conditional knockout resulted in gross malformations of the limbs with complete agenesis of the hindlimb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,952,470 I37T probably damaging Het
Ackr2 A G 9: 121,908,808 Y83C probably damaging Het
Adam19 C T 11: 46,121,576 Q300* probably null Het
Anxa7 C T 14: 20,469,406 A115T probably benign Het
Atad2b A T 12: 5,027,105 R1109* probably null Het
Batf2 A G 19: 6,171,366 T69A probably benign Het
Best1 A G 19: 9,986,813 C428R probably benign Het
Birc6 A G 17: 74,585,985 T973A probably benign Het
Bmp2k C T 5: 97,068,434 T597I unknown Het
Camk2d A T 3: 126,797,730 H283L possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ces1b C A 8: 93,079,504 K36N possibly damaging Het
Ces2a T A 8: 104,739,040 M308K probably benign Het
Ctnnd2 C A 15: 30,683,355 Q501K probably benign Het
Cyb561d1 T C 3: 108,199,313 T197A probably benign Het
Dedd2 C A 7: 25,218,966 A55S probably damaging Het
Dnah2 C T 11: 69,500,817 R684Q probably damaging Het
Elovl3 A G 19: 46,134,540 Y185C probably damaging Het
Fgf3 C T 7: 144,838,832 A42V probably damaging Het
Gabra5 A G 7: 57,490,781 L56P probably damaging Het
Gm19410 T G 8: 35,814,843 V1860G possibly damaging Het
Gm21663 G T 5: 25,938,753 N190K probably damaging Het
Grm3 T A 5: 9,589,581 I155L probably benign Het
Hadha A G 5: 30,122,757 I495T probably damaging Het
Herc4 C T 10: 63,273,586 A200V possibly damaging Het
Itga3 C A 11: 95,076,362 probably benign Het
Krt6a C T 15: 101,693,854 S132N probably benign Het
Lpar1 T C 4: 58,486,857 N138S possibly damaging Het
Lrrc42 T A 4: 107,239,786 T247S probably damaging Het
Man2b1 T A 8: 85,087,175 V256E probably damaging Het
Map3k4 G T 17: 12,271,649 Y298* probably null Het
Mars A G 10: 127,308,586 V195A probably benign Het
Mdm4 A T 1: 132,994,573 V278E probably benign Het
Mdp1 A G 14: 55,660,087 V37A probably damaging Het
Med13 A G 11: 86,308,826 I685T probably benign Het
Mobp A G 9: 120,167,848 N15S probably damaging Het
Nbn T A 4: 15,979,320 M435K probably benign Het
Nfs1 A G 2: 156,123,783 V126A probably benign Het
Npepl1 T A 2: 174,122,116 V480E probably damaging Het
Nr2e3 G A 9: 59,948,689 S155F possibly damaging Het
Olfr1232 A T 2: 89,325,813 Y122* probably null Het
Olfr638 A G 7: 104,003,839 H188R probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Pard3 T C 8: 127,371,575 Y366H probably damaging Het
Pcdhb11 A G 18: 37,421,953 N112S possibly damaging Het
Pde11a A G 2: 76,337,845 S255P probably damaging Het
Piezo1 T C 8: 122,497,529 H745R Het
Pkn2 A T 3: 142,812,015 S441T possibly damaging Het
Pld1 A C 3: 28,076,401 H450P probably damaging Het
Plekhs1 T A 19: 56,470,777 H22Q probably damaging Het
Prss44 A C 9: 110,816,543 Y285S probably damaging Het
Qpctl T C 7: 19,144,927 E249G probably benign Het
Rcsd1 A T 1: 165,663,616 S50T probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scube1 T A 15: 83,621,065 N496Y probably damaging Het
Slc16a8 AGGCC A 15: 79,251,925 probably null Het
Slc38a4 T A 15: 97,005,900 T407S probably benign Het
Slc51a T G 16: 32,479,772 I56L probably benign Het
Slc6a18 T G 13: 73,671,636 I272L probably damaging Het
Sorl1 A G 9: 42,124,079 L12P possibly damaging Het
Svs1 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,988,018 probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Syne1 C T 10: 5,228,218 R4752Q probably damaging Het
Tbc1d9 C A 8: 83,271,328 H1171Q probably damaging Het
Thsd1 G A 8: 22,243,581 V215I probably benign Het
Tmem143 T A 7: 45,908,174 M208K probably benign Het
Tmem63b C T 17: 45,666,122 V440I probably benign Het
Tnik A T 3: 28,646,627 S918C probably damaging Het
Ttc37 A G 13: 76,180,077 M1415V probably benign Het
Ttn A G 2: 76,903,407 I4508T unknown Het
Vav2 A G 2: 27,283,322 F497L probably damaging Het
Zc3h14 G A 12: 98,785,729 R730Q probably damaging Het
Zfp560 G A 9: 20,348,088 H493Y probably damaging Het
Other mutations in Bmpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Bmpr1a APN 14 34434419 missense probably benign
IGL03100:Bmpr1a APN 14 34441207 unclassified probably benign
R0329:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0330:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0411:Bmpr1a UTSW 14 34415877 missense possibly damaging 0.58
R0537:Bmpr1a UTSW 14 34443812 unclassified probably benign
R1707:Bmpr1a UTSW 14 34425141 splice site probably benign
R1767:Bmpr1a UTSW 14 34447770 critical splice donor site probably null
R1992:Bmpr1a UTSW 14 34425093 missense probably damaging 1.00
R3757:Bmpr1a UTSW 14 34434667 nonsense probably null
R4125:Bmpr1a UTSW 14 34434733 missense probably benign 0.35
R5320:Bmpr1a UTSW 14 34425042 missense probably damaging 1.00
R6956:Bmpr1a UTSW 14 34441175 missense possibly damaging 0.90
R7254:Bmpr1a UTSW 14 34414763 missense probably benign 0.03
R7270:Bmpr1a UTSW 14 34441125 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATTTGCTACAAGGAGTAAGTACC -3'
(R):5'- GTCTCCATATATCTCAGTATCTGGTAC -3'

Sequencing Primer
(F):5'- GTCTATGTAGAAAGGACCCTGTCTC -3'
(R):5'- ACAGGGCAGAATCTAGATAG -3'
Posted On2019-06-26