Incidental Mutation 'R0583:Klra17'
ID56506
Institutional Source Beutler Lab
Gene Symbol Klra17
Ensembl Gene ENSMUSG00000014543
Gene Namekiller cell lectin-like receptor, subfamily A, member 17
SynonymsLy49q1, Ly-49Q, Ly49Q
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.030) question?
Stock #R0583 (G1)
Quality Score200
Status Not validated
Chromosome6
Chromosomal Location129831154-129876672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129868693 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 186 (D186V)
Ref Sequence ENSEMBL: ENSMUSP00000114108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014687] [ENSMUST00000122219] [ENSMUST00000171980]
Predicted Effect probably damaging
Transcript: ENSMUST00000014687
AA Change: D186V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014687
Gene: ENSMUSG00000014543
AA Change: D186V

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
Blast:CLECT 73 126 2e-12 BLAST
CLECT 144 259 1.5e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122219
AA Change: D186V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114108
Gene: ENSMUSG00000014543
AA Change: D186V

DomainStartEndE-ValueType
low complexity region 53 70 N/A INTRINSIC
Blast:CLECT 74 127 2e-12 BLAST
CLECT 145 260 1.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171980
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit reduced plasmacytoid dendritic cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Klra17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Klra17 APN 6 129831509 missense probably benign 0.12
IGL02084:Klra17 APN 6 129831593 missense probably damaging 1.00
IGL02995:Klra17 APN 6 129868684 critical splice donor site probably null
IGL03238:Klra17 APN 6 129868810 missense probably benign 0.43
R0118:Klra17 UTSW 6 129831589 missense probably benign 0.01
R1103:Klra17 UTSW 6 129868843 unclassified probably benign
R1378:Klra17 UTSW 6 129865684 missense probably damaging 0.96
R1513:Klra17 UTSW 6 129872314 missense possibly damaging 0.61
R1817:Klra17 UTSW 6 129868718 unclassified probably null
R2262:Klra17 UTSW 6 129874794 critical splice donor site probably null
R2446:Klra17 UTSW 6 129831514 missense probably benign 0.02
R2484:Klra17 UTSW 6 129868757 missense probably damaging 1.00
R3410:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3411:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3739:Klra17 UTSW 6 129873365 missense probably benign 0.03
R4747:Klra17 UTSW 6 129872269 missense probably damaging 0.97
R4956:Klra17 UTSW 6 129873316 missense probably damaging 1.00
R5079:Klra17 UTSW 6 129872196 missense possibly damaging 0.72
R5310:Klra17 UTSW 6 129868708 missense probably damaging 1.00
R5366:Klra17 UTSW 6 129874895 missense possibly damaging 0.89
R5875:Klra17 UTSW 6 129874828 missense probably benign 0.01
R6043:Klra17 UTSW 6 129872187 critical splice donor site probably null
R6515:Klra17 UTSW 6 129831499 missense probably damaging 1.00
R6675:Klra17 UTSW 6 129872323 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGACCCGTGTTCCACAGTCTTAG -3'
(R):5'- TGGTGGTGACCCTACAGTCTTTCTC -3'

Sequencing Primer
(F):5'- TCCAGGGTTACAGACAGAGTCT -3'
(R):5'- gctgggctgattcatttcac -3'
Posted On2013-07-11