Incidental Mutation 'R0583:Mef2a'
ID56509
Institutional Source Beutler Lab
Gene Symbol Mef2a
Ensembl Gene ENSMUSG00000030557
Gene Namemyocyte enhancer factor 2A
SynonymsA430079H05Rik
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0583 (G1)
Quality Score209
Status Not validated
Chromosome7
Chromosomal Location67231163-67372858 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 67235148 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 406 (S406*)
Ref Sequence ENSEMBL: ENSMUSP00000117496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032776] [ENSMUST00000072460] [ENSMUST00000076325] [ENSMUST00000107476] [ENSMUST00000135493] [ENSMUST00000156690] [ENSMUST00000207715] [ENSMUST00000208512]
Predicted Effect probably null
Transcript: ENSMUST00000032776
AA Change: S400*
SMART Domains Protein: ENSMUSP00000032776
Gene: ENSMUSG00000030557
AA Change: S400*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072460
SMART Domains Protein: ENSMUSP00000138645
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076325
AA Change: S400*
SMART Domains Protein: ENSMUSP00000075664
Gene: ENSMUSG00000030557
AA Change: S400*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107476
AA Change: S398*
SMART Domains Protein: ENSMUSP00000103100
Gene: ENSMUSG00000030557
AA Change: S398*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 410 429 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135493
AA Change: S406*
SMART Domains Protein: ENSMUSP00000138566
Gene: ENSMUSG00000030557
AA Change: S406*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156690
AA Change: S406*
SMART Domains Protein: ENSMUSP00000117496
Gene: ENSMUSG00000030557
AA Change: S406*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 152 1.3e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207794
Predicted Effect probably benign
Transcript: ENSMUST00000208512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208569
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Inactivation of this gene results in cardiac sudden death. Mice dying in the early postnatal period exhibit ventricular dilation, while mice dying in adulthood show a reduced number of mitochondria in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Mef2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Mef2a APN 7 67264872 missense probably damaging 0.98
IGL02112:Mef2a APN 7 67264872 missense probably damaging 0.98
P0024:Mef2a UTSW 7 67295574 missense probably damaging 1.00
R0390:Mef2a UTSW 7 67251724 missense probably damaging 0.96
R0584:Mef2a UTSW 7 67235148 nonsense probably null
R0589:Mef2a UTSW 7 67235148 nonsense probably null
R0597:Mef2a UTSW 7 67235148 nonsense probably null
R0608:Mef2a UTSW 7 67235148 nonsense probably null
R0704:Mef2a UTSW 7 67235148 nonsense probably null
R1859:Mef2a UTSW 7 67266018 missense probably damaging 0.97
R2166:Mef2a UTSW 7 67266122 missense probably damaging 1.00
R2427:Mef2a UTSW 7 67266060 missense probably damaging 0.98
R3618:Mef2a UTSW 7 67268327 missense probably benign 0.34
R3619:Mef2a UTSW 7 67268327 missense probably benign 0.34
R4576:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4577:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4578:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4635:Mef2a UTSW 7 67240427 missense possibly damaging 0.67
R5805:Mef2a UTSW 7 67251668 missense possibly damaging 0.89
X0011:Mef2a UTSW 7 67235164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTAGGTCACCCATGTGTCC -3'
(R):5'- TTAGGCCCTCAGTCTTCTCAGACAG -3'

Sequencing Primer
(F):5'- CCTCATGCGTTTTACAGAAGG -3'
(R):5'- CAGACAGTTTCCTGAGCTTTG -3'
Posted On2013-07-11