Incidental Mutation 'R7268:Ahnak2'
ID565099
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7268 (G1)
Quality Score203.009
Status Not validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112780802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 70 (V70E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124526] [ENSMUST00000128258]
Predicted Effect probably benign
Transcript: ENSMUST00000124526
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812
AA Change: V70E

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Alb T A 5: 90,462,716 S52T probably benign Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
R7508:Ahnak2 UTSW 12 112774405 missense possibly damaging 0.46
R7560:Ahnak2 UTSW 12 112779674 missense
Predicted Primers PCR Primer
(F):5'- GAACTTGCTGTCTTTGGCC -3'
(R):5'- AGTTCAAGATGCCCTCCTTTG -3'

Sequencing Primer
(F):5'- TGTCTTTGGCCGCCACG -3'
(R):5'- TGAAGACCCCTGACCTGAG -3'
Posted On2019-06-26