Incidental Mutation 'R7269:Per3'
ID565134
Institutional Source Beutler Lab
Gene Symbol Per3
Ensembl Gene ENSMUSG00000028957
Gene Nameperiod circadian clock 3
SynonymsmPer3, 2810049O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R7269 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location151003652-151044665 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 151031936 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 278 (C278*)
Ref Sequence ENSEMBL: ENSMUSP00000099493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103204] [ENSMUST00000136398] [ENSMUST00000169423]
PDB Structure
Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000103204
AA Change: C278*
SMART Domains Protein: ENSMUSP00000099493
Gene: ENSMUSG00000028957
AA Change: C278*

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 1.52e-1 SMART
low complexity region 414 427 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Pfam:Period_C 905 1111 4.4e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136398
AA Change: C278*
SMART Domains Protein: ENSMUSP00000118950
Gene: ENSMUSG00000028957
AA Change: C278*

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 3.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been linked to sleep disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit a shorter circadian cycle length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A T 18: 24,472,956 N36I probably damaging Het
A430033K04Rik T A 5: 138,646,752 Y300N possibly damaging Het
Adipor2 T C 6: 119,370,244 Q26R probably benign Het
Ahnak T A 19: 9,006,617 M1755K probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
AI837181 C A 19: 5,426,434 S208R probably damaging Het
Akap2 G T 4: 57,855,217 R182L probably damaging Het
Arhgap35 T G 7: 16,561,727 M1138L probably benign Het
Card14 T G 11: 119,337,747 L633R probably damaging Het
Carmil3 A G 14: 55,493,895 T144A probably benign Het
Cbfa2t2 T A 2: 154,515,975 N223K probably benign Het
Ccdc39 T C 3: 33,830,105 I363V probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccpg1 G T 9: 73,013,327 R741S probably benign Het
Cenpc1 A G 5: 86,013,507 F855L probably damaging Het
Cenpc1 A T 5: 86,032,418 M665K probably benign Het
Cp A G 3: 19,983,477 H832R probably damaging Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dlc1 A C 8: 36,579,253 L730R probably damaging Het
Dmbt1 A T 7: 131,066,621 I536F unknown Het
Dscam G A 16: 96,678,401 T1182I probably benign Het
Eea1 A T 10: 96,018,138 I553F probably damaging Het
Far1 T C 7: 113,561,447 V400A probably benign Het
Fbrsl1 A T 5: 110,433,014 S126T probably benign Het
Frmpd2 A T 14: 33,522,881 E552V possibly damaging Het
Gm5431 T A 11: 48,888,410 T562S probably benign Het
Gm5475 T C 15: 100,427,009 F106S unknown Het
Gpr12 T C 5: 146,583,378 T245A probably damaging Het
Gsta2 A G 9: 78,332,137 Y166H probably benign Het
H6pd A G 4: 149,982,912 V347A probably benign Het
Ifih1 T C 2: 62,645,633 T100A probably benign Het
Itga2 C T 13: 114,886,689 W59* probably null Het
Knstrn T A 2: 118,831,388 probably null Het
Kprp A G 3: 92,823,871 V624A probably damaging Het
Lmbrd2 A G 15: 9,194,684 Y591C probably damaging Het
Map7d1 A G 4: 126,232,873 V842A unknown Het
Mboat2 A T 12: 24,831,709 T4S probably benign Het
Mcph1 T A 8: 18,607,272 probably null Het
Mkl2 A T 16: 13,401,034 M515L possibly damaging Het
Muc5b A G 7: 141,857,535 D1406G unknown Het
Mylk G A 16: 34,785,011 G3D probably damaging Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nemp1 G T 10: 127,695,476 R361L probably damaging Het
Nol4 A C 18: 23,039,789 V85G probably benign Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Obscn T C 11: 59,043,012 E5342G probably damaging Het
Olfr1180 C T 2: 88,412,495 M54I possibly damaging Het
Olfr129 C A 17: 38,055,551 C5F probably damaging Het
Olfr1317 T A 2: 112,142,560 F205Y probably damaging Het
Olfr557 T G 7: 102,699,045 L269R probably damaging Het
Olfr77 A G 9: 19,920,335 N42S possibly damaging Het
Pde4dip A G 3: 97,766,959 S214P probably damaging Het
Pi4k2a T C 19: 42,090,686 L62P probably damaging Het
Plekha7 C A 7: 116,181,212 G126W probably damaging Het
Ppp1r13b T C 12: 111,834,919 K567E probably damaging Het
Pradc1 T A 6: 85,447,566 Q134L probably benign Het
Pwp2 A G 10: 78,176,336 F628L probably benign Het
Rab5c C T 11: 100,716,102 G217D probably benign Het
Rad51ap2 G T 12: 11,456,806 S243I possibly damaging Het
Rasgrp4 C A 7: 29,148,430 R432S probably damaging Het
Rhot2 C T 17: 25,842,428 probably null Het
Scn2a T A 2: 65,763,769 L1654Q probably damaging Het
Skint6 A T 4: 112,854,489 probably null Het
Slc22a28 T A 19: 8,117,127 T177S probably benign Het
Slc25a24 G T 3: 109,158,644 Q272H probably null Het
Slc3a1 A T 17: 85,032,445 I144F probably damaging Het
Smg9 C T 7: 24,406,070 R176C possibly damaging Het
Sorl1 A T 9: 42,037,203 L762Q probably damaging Het
Srebf2 C A 15: 82,204,069 P1079T probably benign Het
Sub1 A T 15: 11,993,851 S4T probably benign Het
Tacr1 A T 6: 82,492,711 Y192F probably benign Het
Tm4sf19 A T 16: 32,405,996 H54L probably damaging Het
Tnxb T C 17: 34,695,454 L1838P probably damaging Het
Trmt1l T C 1: 151,457,788 S681P possibly damaging Het
Ttc30b A G 2: 75,937,494 F305S probably damaging Het
Ttn A G 2: 76,907,832 V4167A unknown Het
Unc13d T A 11: 116,068,230 M702L probably benign Het
Vgll3 A G 16: 65,839,518 H240R probably benign Het
Vmn1r189 C G 13: 22,102,567 W33C probably benign Het
Vmn2r17 G A 5: 109,428,471 A403T possibly damaging Het
Vmn2r2 G A 3: 64,126,577 T508I probably benign Het
Vps54 T A 11: 21,277,670 probably null Het
Wfs1 G A 5: 36,967,790 Q586* probably null Het
Zbp1 A T 2: 173,213,872 H166Q unknown Het
Zcchc3 G A 2: 152,414,374 A135V probably benign Het
Zfp51 T C 17: 21,463,698 Y192H probably benign Het
Zkscan2 T C 7: 123,489,771 T426A probably benign Het
Other mutations in Per3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Per3 APN 4 151013598 missense probably benign 0.28
IGL02112:Per3 APN 4 151029183 missense probably benign 0.20
IGL02428:Per3 APN 4 151018217 critical splice donor site probably null
IGL02812:Per3 APN 4 151024470 missense probably damaging 0.99
IGL03094:Per3 APN 4 151009298 missense probably damaging 1.00
R0119:Per3 UTSW 4 151024548 intron probably benign
R0565:Per3 UTSW 4 151033952 missense probably damaging 1.00
R0671:Per3 UTSW 4 151028831 missense probably benign 0.27
R1186:Per3 UTSW 4 151026138 missense probably damaging 0.99
R1736:Per3 UTSW 4 151009248 critical splice donor site probably null
R1757:Per3 UTSW 4 151042792 critical splice acceptor site probably null
R1900:Per3 UTSW 4 151041426 missense probably damaging 1.00
R1929:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2044:Per3 UTSW 4 151033938 missense probably benign 0.01
R2272:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2415:Per3 UTSW 4 151012690 missense possibly damaging 0.91
R4771:Per3 UTSW 4 151009259 missense probably damaging 1.00
R5199:Per3 UTSW 4 151012895 missense probably benign 0.15
R5298:Per3 UTSW 4 151029209 missense probably damaging 1.00
R5330:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5331:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5920:Per3 UTSW 4 151012450 missense probably benign 0.05
R5974:Per3 UTSW 4 151042737 missense possibly damaging 0.83
R6498:Per3 UTSW 4 151029205 missense probably benign 0.27
R6907:Per3 UTSW 4 151043558 critical splice donor site probably null
R6915:Per3 UTSW 4 151043649 missense possibly damaging 0.84
R7454:Per3 UTSW 4 151012728 missense probably benign 0.05
R7555:Per3 UTSW 4 151018058 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCAATCTAAGCTGGACTGTAAC -3'
(R):5'- TTGTAGCTTTGACCCCAGAC -3'

Sequencing Primer
(F):5'- TGGACTGTAACCAGCCGGAG -3'
(R):5'- GTAGCTTTGACCCCAGACCAGTC -3'
Posted On2019-06-26