Incidental Mutation 'R7270:Aimp1'
ID565217
Institutional Source Beutler Lab
Gene Symbol Aimp1
Ensembl Gene ENSMUSG00000028029
Gene Nameaminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Synonyms9830137A06Rik, AIMP1/p43, Scye1, Emap2, EMAPII
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R7270 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location132660499-132684370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132677011 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 44 (K44E)
Ref Sequence ENSEMBL: ENSMUSP00000029663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029663] [ENSMUST00000196206] [ENSMUST00000196963] [ENSMUST00000197793] [ENSMUST00000198513]
Predicted Effect probably damaging
Transcript: ENSMUST00000029663
AA Change: K44E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029663
Gene: ENSMUSG00000028029
AA Change: K44E

DomainStartEndE-ValueType
coiled coil region 17 84 N/A INTRINSIC
low complexity region 124 144 N/A INTRINSIC
Pfam:tRNA_bind 164 257 2.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196206
AA Change: K35E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142914
Gene: ENSMUSG00000028029
AA Change: K35E

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196963
AA Change: K35E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000197793
AA Change: K35E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142534
Gene: ENSMUSG00000028029
AA Change: K35E

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198513
AA Change: K35E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142513
Gene: ENSMUSG00000028029
AA Change: K35E

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display delayed wound healing and decreased inflammatory response after wounding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l A T 10: 42,425,249 Y193N probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
Arid1b T A 17: 4,996,043 Y369N unknown Het
Art5 A T 7: 102,097,873 V233D probably damaging Het
Baz2b T A 2: 59,962,492 N431Y possibly damaging Het
Bik T A 15: 83,544,163 F131I possibly damaging Het
Bmpr1a A G 14: 34,441,125 Y103H probably damaging Het
Cabp7 C T 11: 4,746,676 V18M possibly damaging Het
Cacna1a C A 8: 84,571,237 T1240N probably damaging Het
Cacna1h A G 17: 25,384,765 V1311A probably damaging Het
Cbarp A C 10: 80,137,317 S16A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2b A T 8: 104,837,840 H494L possibly damaging Het
Cfap43 T A 19: 47,739,785 H1511L possibly damaging Het
Cfap54 A G 10: 92,839,458 V2867A probably benign Het
Col5a1 C T 2: 27,997,585 P956L unknown Het
Dcakd T G 11: 103,000,206 Q19P possibly damaging Het
Ddx47 T A 6: 135,023,338 D432E probably benign Het
Dhrs7b T C 11: 60,844,229 F29L probably benign Het
Dis3l2 A T 1: 86,990,303 D558V possibly damaging Het
Dtx3l T A 16: 35,933,657 D193V probably damaging Het
Epha4 G A 1: 77,399,785 R486C probably damaging Het
Fam186a T C 15: 99,944,152 T1404A possibly damaging Het
Fat1 A G 8: 45,037,438 T3796A probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Ftmt A G 18: 52,332,019 I136V probably benign Het
Gm10300 T C 4: 132,074,856 W54R unknown Het
Gm10518 C T 1: 179,803,384 P3L unknown Het
Gm5788 T C 12: 87,494,893 L58P probably damaging Het
Gm9733 A T 3: 15,320,644 I66N probably benign Het
Grm2 G A 9: 106,651,058 T209M probably damaging Het
Gtdc1 C T 2: 44,635,310 M176I probably benign Het
Insrr T C 3: 87,803,133 L382P probably damaging Het
Jade2 A G 11: 51,817,184 V734A possibly damaging Het
Kcnh4 C T 11: 100,747,646 R586H probably benign Het
Kdm1a A T 4: 136,552,527 D721E probably damaging Het
Knl1 G A 2: 119,102,522 C2054Y possibly damaging Het
Lrrk2 C T 15: 91,700,441 P354S probably benign Het
Luzp2 A G 7: 55,075,026 I112V probably damaging Het
Mgl2 T C 11: 70,135,680 S105P probably damaging Het
Mocs1 T A 17: 49,449,115 M200K possibly damaging Het
Oat T A 7: 132,567,198 I98L probably benign Het
Obscn T C 11: 59,029,486 Y8C Het
Olfr1462 G A 19: 13,191,404 V246I possibly damaging Het
Olfr786 T G 10: 129,437,450 F213V probably benign Het
Pde1b T A 15: 103,521,655 M137K possibly damaging Het
Phf21a T C 2: 92,327,139 I204T probably damaging Het
Plcd4 A G 1: 74,554,679 E321G possibly damaging Het
Plpp7 C T 2: 32,095,650 probably benign Het
Prdm1 A G 10: 44,441,570 I419T probably benign Het
Sec16b A T 1: 157,564,462 R855W probably damaging Het
Sec16b G T 1: 157,564,463 R855M probably damaging Het
Sec31b T C 19: 44,523,043 T640A probably benign Het
Siglec1 T C 2: 131,081,551 T425A possibly damaging Het
Skil T C 3: 31,097,175 probably benign Het
Slc1a5 G A 7: 16,785,698 V200M probably damaging Het
Slc25a12 T C 2: 71,324,025 H139R probably benign Het
Slc25a32 A T 15: 39,098,235 V187D probably damaging Het
Slc35a3 G A 3: 116,711,806 probably benign Het
Smap2 C A 4: 120,972,067 M328I probably benign Het
Spef2 C T 15: 9,599,980 probably null Het
Srarp A G 4: 141,433,078 V148A possibly damaging Het
Stard9 T A 2: 120,634,274 Y73* probably null Het
Tars A G 15: 11,392,019 C236R probably benign Het
Tchh G C 3: 93,444,530 D426H unknown Het
Tnks2 T C 19: 36,859,145 F17S Het
Ube2g1 T C 11: 72,663,113 I30T possibly damaging Het
Ube2o C T 11: 116,543,935 D567N possibly damaging Het
Unc5b A T 10: 60,772,223 Y710* probably null Het
Vmn1r215 T C 13: 23,075,919 V43A possibly damaging Het
Xkr8 A G 4: 132,728,337 F242L probably benign Het
Zfp526 T A 7: 25,225,920 C535S probably damaging Het
Other mutations in Aimp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Aimp1 APN 3 132677143 splice site probably benign
IGL00742:Aimp1 APN 3 132671981 nonsense probably null
IGL01863:Aimp1 APN 3 132672092 missense probably benign 0.03
IGL02432:Aimp1 APN 3 132673977 missense probably benign
R0305:Aimp1 UTSW 3 132673986 missense possibly damaging 0.89
R0699:Aimp1 UTSW 3 132674865 splice site probably benign
R1734:Aimp1 UTSW 3 132674796 missense probably damaging 1.00
R1793:Aimp1 UTSW 3 132674064 missense probably benign 0.21
R1975:Aimp1 UTSW 3 132677099 missense possibly damaging 0.81
R2010:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4424:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4583:Aimp1 UTSW 3 132677047 missense probably damaging 0.99
R6135:Aimp1 UTSW 3 132672083 missense probably benign 0.30
R6285:Aimp1 UTSW 3 132667504 missense possibly damaging 0.81
X0057:Aimp1 UTSW 3 132677112 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACGCAAATACAACATTCACTATAGAT -3'
(R):5'- CTCAGTTGTAGGAGAAAGGGTT -3'

Sequencing Primer
(F):5'- ATTAAGGGAATCTAAAAGCCA -3'
(R):5'- TTCTCAGCATCCTGTAAAAAGCTCG -3'
Posted On2019-06-26