Incidental Mutation 'R7270:Cacna1a'
ID565232
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R7270 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84571237 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1240 (T1240N)
Ref Sequence ENSEMBL: ENSMUSP00000112436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect probably damaging
Transcript: ENSMUST00000121390
AA Change: T1240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: T1240N

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122053
AA Change: T1193N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: T1193N

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l A T 10: 42,425,249 Y193N probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
Aimp1 T C 3: 132,677,011 K44E probably damaging Het
Arid1b T A 17: 4,996,043 Y369N unknown Het
Art5 A T 7: 102,097,873 V233D probably damaging Het
Baz2b T A 2: 59,962,492 N431Y possibly damaging Het
Bik T A 15: 83,544,163 F131I possibly damaging Het
Bmpr1a A G 14: 34,441,125 Y103H probably damaging Het
Cabp7 C T 11: 4,746,676 V18M possibly damaging Het
Cacna1h A G 17: 25,384,765 V1311A probably damaging Het
Cbarp A C 10: 80,137,317 S16A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2b A T 8: 104,837,840 H494L possibly damaging Het
Cfap43 T A 19: 47,739,785 H1511L possibly damaging Het
Cfap54 A G 10: 92,839,458 V2867A probably benign Het
Col5a1 C T 2: 27,997,585 P956L unknown Het
Dcakd T G 11: 103,000,206 Q19P possibly damaging Het
Ddx47 T A 6: 135,023,338 D432E probably benign Het
Dhrs7b T C 11: 60,844,229 F29L probably benign Het
Dis3l2 A T 1: 86,990,303 D558V possibly damaging Het
Dtx3l T A 16: 35,933,657 D193V probably damaging Het
Epha4 G A 1: 77,399,785 R486C probably damaging Het
Fam186a T C 15: 99,944,152 T1404A possibly damaging Het
Fat1 A G 8: 45,037,438 T3796A probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Ftmt A G 18: 52,332,019 I136V probably benign Het
Gm10300 T C 4: 132,074,856 W54R unknown Het
Gm10518 C T 1: 179,803,384 P3L unknown Het
Gm5788 T C 12: 87,494,893 L58P probably damaging Het
Gm9733 A T 3: 15,320,644 I66N probably benign Het
Grm2 G A 9: 106,651,058 T209M probably damaging Het
Gtdc1 C T 2: 44,635,310 M176I probably benign Het
Insrr T C 3: 87,803,133 L382P probably damaging Het
Jade2 A G 11: 51,817,184 V734A possibly damaging Het
Kcnh4 C T 11: 100,747,646 R586H probably benign Het
Kdm1a A T 4: 136,552,527 D721E probably damaging Het
Knl1 G A 2: 119,102,522 C2054Y possibly damaging Het
Lrrk2 C T 15: 91,700,441 P354S probably benign Het
Luzp2 A G 7: 55,075,026 I112V probably damaging Het
Mgl2 T C 11: 70,135,680 S105P probably damaging Het
Mocs1 T A 17: 49,449,115 M200K possibly damaging Het
Oat T A 7: 132,567,198 I98L probably benign Het
Obscn T C 11: 59,029,486 Y8C Het
Olfr1462 G A 19: 13,191,404 V246I possibly damaging Het
Olfr786 T G 10: 129,437,450 F213V probably benign Het
Pde1b T A 15: 103,521,655 M137K possibly damaging Het
Phf21a T C 2: 92,327,139 I204T probably damaging Het
Plcd4 A G 1: 74,554,679 E321G possibly damaging Het
Plpp7 C T 2: 32,095,650 probably benign Het
Prdm1 A G 10: 44,441,570 I419T probably benign Het
Sec16b A T 1: 157,564,462 R855W probably damaging Het
Sec16b G T 1: 157,564,463 R855M probably damaging Het
Sec31b T C 19: 44,523,043 T640A probably benign Het
Siglec1 T C 2: 131,081,551 T425A possibly damaging Het
Skil T C 3: 31,097,175 probably benign Het
Slc1a5 G A 7: 16,785,698 V200M probably damaging Het
Slc25a12 T C 2: 71,324,025 H139R probably benign Het
Slc25a32 A T 15: 39,098,235 V187D probably damaging Het
Slc35a3 G A 3: 116,711,806 probably benign Het
Smap2 C A 4: 120,972,067 M328I probably benign Het
Spef2 C T 15: 9,599,980 probably null Het
Srarp A G 4: 141,433,078 V148A possibly damaging Het
Stard9 T A 2: 120,634,274 Y73* probably null Het
Tars A G 15: 11,392,019 C236R probably benign Het
Tchh G C 3: 93,444,530 D426H unknown Het
Tnks2 T C 19: 36,859,145 F17S Het
Ube2g1 T C 11: 72,663,113 I30T possibly damaging Het
Ube2o C T 11: 116,543,935 D567N possibly damaging Het
Unc5b A T 10: 60,772,223 Y710* probably null Het
Vmn1r215 T C 13: 23,075,919 V43A possibly damaging Het
Xkr8 A G 4: 132,728,337 F242L probably benign Het
Zfp526 T A 7: 25,225,920 C535S probably damaging Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TTTGATCCTGCCTAGGCGTG -3'
(R):5'- CAGAGTCTCTCTTCTGCCTAGAGC -3'

Sequencing Primer
(F):5'- TAGGCGTGGCTCCAGAC -3'
(R):5'- TAGAGCCCTCCTCCATGAC -3'
Posted On2019-06-26