Incidental Mutation 'R7272:Zgrf1'
ID565342
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7272 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127598760 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1310 (I1310F)
Ref Sequence ENSEMBL: ENSMUSP00000044432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect probably damaging
Transcript: ENSMUST00000043108
AA Change: I1310F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: I1310F

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196141
AA Change: I1310F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: I1310F

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196341
AA Change: I426F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278
AA Change: I426F

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,536 I1020T probably benign Het
2310057N15Rik A T 16: 88,773,635 Y172* probably null Het
4930558K02Rik T A 1: 161,942,523 Y139F possibly damaging Het
A830018L16Rik T G 1: 11,588,471 M202R probably damaging Het
Abca12 T C 1: 71,248,432 E2450G probably damaging Het
Ank2 C T 3: 126,943,133 R3034H unknown Het
Anxa9 A G 3: 95,305,873 I54T probably damaging Het
Aspm T C 1: 139,458,328 I570T probably benign Het
Bcar3 A T 3: 122,508,396 I247F possibly damaging Het
Cep350 A G 1: 155,953,588 V130A probably damaging Het
Cep89 A T 7: 35,438,463 R757S probably benign Het
Cryga A T 1: 65,103,222 I4N probably damaging Het
Cyp2d26 T A 15: 82,792,563 Y194F probably benign Het
Edn2 G A 4: 120,161,946 R44H probably damaging Het
Ep400 G A 5: 110,755,645 Q363* probably null Het
Gpr33 T C 12: 52,024,065 T64A probably damaging Het
Ice2 T A 9: 69,417,083 S763T possibly damaging Het
Itgad C A 7: 128,205,073 F1169L probably damaging Het
Kcnv1 A G 15: 45,113,180 L237P probably benign Het
Kctd18 T C 1: 57,956,551 E356G probably damaging Het
Krt33a C T 11: 100,012,011 R329Q probably damaging Het
Lama2 C A 10: 27,124,556 G1657C probably damaging Het
March3 T G 18: 56,762,521 R217S probably benign Het
Mmel1 A T 4: 154,894,090 T660S probably damaging Het
Ms4a7 T A 19: 11,333,278 K59* probably null Het
Mss51 G A 14: 20,484,913 T263I probably damaging Het
Ncaph2 A G 15: 89,364,182 M199V probably benign Het
Ndufa4 G A 6: 11,905,210 Q62* probably null Het
Nectin4 A G 1: 171,386,644 T456A probably damaging Het
Nek1 T C 8: 61,125,086 M1214T probably benign Het
Nsf T A 11: 103,827,238 L710F probably damaging Het
Nynrin G T 14: 55,870,415 G993V probably damaging Het
Olfr391-ps T A 11: 73,798,869 D296V probably damaging Het
Pbk T A 14: 65,815,172 Y155N probably damaging Het
Plec T C 15: 76,174,953 I3595V possibly damaging Het
Pom121 G A 5: 135,381,087 T1072I unknown Het
Sdc1 T A 12: 8,790,554 H106Q probably benign Het
Slc44a3 T C 3: 121,461,115 D618G probably damaging Het
Slc9c1 A G 16: 45,581,515 D755G possibly damaging Het
Slfn9 T C 11: 82,981,561 Y783C probably benign Het
Spindoc C T 19: 7,382,720 E28K possibly damaging Het
Sptbn1 T C 11: 30,114,859 D1880G possibly damaging Het
Sspn T A 6: 145,961,474 D210E probably benign Het
Stx12 A T 4: 132,857,376 I219K possibly damaging Het
Syne2 T C 12: 76,048,643 V508A probably benign Het
Tkt G T 14: 30,565,607 R186L probably damaging Het
Trmt10a T A 3: 138,154,766 M241K probably damaging Het
Vgll2 C A 10: 52,027,662 A207E possibly damaging Het
Vmn1r114 A G 7: 20,811,618 F190S probably damaging Het
Xpot C T 10: 121,617,189 probably null Het
Zfp385c C T 11: 100,630,039 R265K possibly damaging Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAACGTGCCATCTGACTAGTT -3'
(R):5'- CTGATATTGTACTTTCCGTTACCACT -3'

Sequencing Primer
(F):5'- CTAGTTCAGAAGATAACCTCTGAGG -3'
(R):5'- AATGTCTCTACCAATGGCCCATGG -3'
Posted On2019-06-26