Incidental Mutation 'R7272:Slfn9'
ID565361
Institutional Source Beutler Lab
Gene Symbol Slfn9
Ensembl Gene ENSMUSG00000069793
Gene Nameschlafen 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7272 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location82978390-82991830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82981561 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 783 (Y783C)
Ref Sequence ENSEMBL: ENSMUSP00000044435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038211] [ENSMUST00000092840] [ENSMUST00000138797]
Predicted Effect probably benign
Transcript: ENSMUST00000038211
AA Change: Y783C

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044435
Gene: ENSMUSG00000069793
AA Change: Y783C

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AlbA_2 205 343 2.3e-17 PFAM
Pfam:DUF2075 592 766 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092840
AA Change: Y783C

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090515
Gene: ENSMUSG00000069793
AA Change: Y783C

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 1.6e-18 PFAM
Pfam:DUF2075 592 766 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138797
SMART Domains Protein: ENSMUSP00000115273
Gene: ENSMUSG00000069793

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 3.8e-19 PFAM
Pfam:DUF2075 592 642 1.9e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,536 I1020T probably benign Het
2310057N15Rik A T 16: 88,773,635 Y172* probably null Het
4930558K02Rik T A 1: 161,942,523 Y139F possibly damaging Het
A830018L16Rik T G 1: 11,588,471 M202R probably damaging Het
Abca12 T C 1: 71,248,432 E2450G probably damaging Het
Ank2 C T 3: 126,943,133 R3034H unknown Het
Anxa9 A G 3: 95,305,873 I54T probably damaging Het
Aspm T C 1: 139,458,328 I570T probably benign Het
Bcar3 A T 3: 122,508,396 I247F possibly damaging Het
Cep350 A G 1: 155,953,588 V130A probably damaging Het
Cep89 A T 7: 35,438,463 R757S probably benign Het
Cryga A T 1: 65,103,222 I4N probably damaging Het
Cyp2d26 T A 15: 82,792,563 Y194F probably benign Het
Edn2 G A 4: 120,161,946 R44H probably damaging Het
Ep400 G A 5: 110,755,645 Q363* probably null Het
Gpr33 T C 12: 52,024,065 T64A probably damaging Het
Ice2 T A 9: 69,417,083 S763T possibly damaging Het
Itgad C A 7: 128,205,073 F1169L probably damaging Het
Kcnv1 A G 15: 45,113,180 L237P probably benign Het
Kctd18 T C 1: 57,956,551 E356G probably damaging Het
Krt33a C T 11: 100,012,011 R329Q probably damaging Het
Lama2 C A 10: 27,124,556 G1657C probably damaging Het
March3 T G 18: 56,762,521 R217S probably benign Het
Mmel1 A T 4: 154,894,090 T660S probably damaging Het
Ms4a7 T A 19: 11,333,278 K59* probably null Het
Mss51 G A 14: 20,484,913 T263I probably damaging Het
Ncaph2 A G 15: 89,364,182 M199V probably benign Het
Ndufa4 G A 6: 11,905,210 Q62* probably null Het
Nectin4 A G 1: 171,386,644 T456A probably damaging Het
Nek1 T C 8: 61,125,086 M1214T probably benign Het
Nsf T A 11: 103,827,238 L710F probably damaging Het
Nynrin G T 14: 55,870,415 G993V probably damaging Het
Olfr391-ps T A 11: 73,798,869 D296V probably damaging Het
Pbk T A 14: 65,815,172 Y155N probably damaging Het
Plec T C 15: 76,174,953 I3595V possibly damaging Het
Pom121 G A 5: 135,381,087 T1072I unknown Het
Sdc1 T A 12: 8,790,554 H106Q probably benign Het
Slc44a3 T C 3: 121,461,115 D618G probably damaging Het
Slc9c1 A G 16: 45,581,515 D755G possibly damaging Het
Spindoc C T 19: 7,382,720 E28K possibly damaging Het
Sptbn1 T C 11: 30,114,859 D1880G possibly damaging Het
Sspn T A 6: 145,961,474 D210E probably benign Het
Stx12 A T 4: 132,857,376 I219K possibly damaging Het
Syne2 T C 12: 76,048,643 V508A probably benign Het
Tkt G T 14: 30,565,607 R186L probably damaging Het
Trmt10a T A 3: 138,154,766 M241K probably damaging Het
Vgll2 C A 10: 52,027,662 A207E possibly damaging Het
Vmn1r114 A G 7: 20,811,618 F190S probably damaging Het
Xpot C T 10: 121,617,189 probably null Het
Zfp385c C T 11: 100,630,039 R265K possibly damaging Het
Zgrf1 A T 3: 127,598,760 I1310F probably damaging Het
Other mutations in Slfn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slfn9 APN 11 82981371 nonsense probably null
IGL01340:Slfn9 APN 11 82981751 missense probably benign 0.29
IGL01543:Slfn9 APN 11 82987949 missense probably benign
IGL01735:Slfn9 APN 11 82982332 missense probably damaging 1.00
IGL01778:Slfn9 APN 11 82987374 missense probably damaging 0.98
IGL01863:Slfn9 APN 11 82981325 missense probably benign 0.27
IGL01997:Slfn9 APN 11 82987677 missense possibly damaging 0.80
IGL02380:Slfn9 APN 11 82981220 missense probably benign 0.23
IGL02993:Slfn9 APN 11 82981196 missense probably benign 0.18
R1463:Slfn9 UTSW 11 82981698 missense possibly damaging 0.78
R1687:Slfn9 UTSW 11 82982157 missense probably damaging 0.99
R1786:Slfn9 UTSW 11 82981307 missense probably damaging 0.99
R1796:Slfn9 UTSW 11 82981955 missense probably benign 0.00
R1870:Slfn9 UTSW 11 82981576 missense probably benign
R1871:Slfn9 UTSW 11 82981576 missense probably benign
R2004:Slfn9 UTSW 11 82988201 missense probably benign 0.25
R2024:Slfn9 UTSW 11 82981681 missense probably damaging 1.00
R2106:Slfn9 UTSW 11 82987680 missense possibly damaging 0.89
R2140:Slfn9 UTSW 11 82984655 missense possibly damaging 0.76
R3004:Slfn9 UTSW 11 82981764 missense possibly damaging 0.94
R4293:Slfn9 UTSW 11 82982508 missense probably benign 0.01
R4927:Slfn9 UTSW 11 82981390 missense possibly damaging 0.47
R4950:Slfn9 UTSW 11 82981904 missense probably benign
R5471:Slfn9 UTSW 11 82982787 missense possibly damaging 0.85
R5543:Slfn9 UTSW 11 82982381 missense probably damaging 1.00
R5576:Slfn9 UTSW 11 82981432 missense probably benign
R5996:Slfn9 UTSW 11 82987484 missense possibly damaging 0.67
R7421:Slfn9 UTSW 11 82981371 nonsense probably null
R7421:Slfn9 UTSW 11 82987736 missense probably damaging 0.96
R7498:Slfn9 UTSW 11 82982187 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGACAGACAGACTCGTCATTC -3'
(R):5'- AGTGGCCTCCCAGATTTCTC -3'

Sequencing Primer
(F):5'- CAGACAGACTCGTCATTCATGTGAG -3'
(R):5'- GATTTCTCACTCCAGTATCCAAAGG -3'
Posted On2019-06-26