Incidental Mutation 'R7275:Nfasc'
ID565489
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7275 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 132634263 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 147 (L147R)
Ref Sequence ENSEMBL: ENSMUSP00000092148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043189
AA Change: L141R

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: L141R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094569
AA Change: L147R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: L147R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163770
AA Change: L141R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: L141R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000187861
AA Change: L147R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: L147R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188307
AA Change: L141R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: L141R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Gpat2 G C 2: 127,431,367 G224R possibly damaging Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 unclassified probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCGGACTCTGAGTGAGC -3'
(R):5'- AAGATGAGTGTCCCCGTCAC -3'

Sequencing Primer
(F):5'- TGTGGCATCTCTGAACCAAG -3'
(R):5'- TGAGTGTCCCCGTCACAGAAAG -3'
Posted On2019-06-26