Incidental Mutation 'R7275:Olfr340'
ID565494
Institutional Source Beutler Lab
Gene Symbol Olfr340
Ensembl Gene ENSMUSG00000094266
Gene Nameolfactory receptor 340
SynonymsGA_x6K02T2NLDC-33147742-33148680, MOR136-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7275 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36452587-36453525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36452839 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 85 (M85L)
Ref Sequence ENSEMBL: ENSMUSP00000072632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072854]
Predicted Effect probably benign
Transcript: ENSMUST00000072854
AA Change: M85L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072632
Gene: ENSMUSG00000094266
AA Change: M85L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.8e-6 PFAM
Pfam:7tm_1 41 290 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Gpat2 G C 2: 127,431,367 G224R possibly damaging Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Other mutations in Olfr340
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Olfr340 APN 2 36452644 nonsense probably null
IGL01590:Olfr340 APN 2 36452992 missense probably benign 0.39
IGL01614:Olfr340 APN 2 36452624 missense probably benign 0.32
IGL02470:Olfr340 APN 2 36452597 missense probably benign 0.00
IGL02943:Olfr340 APN 2 36453039 missense probably benign 0.05
R0089:Olfr340 UTSW 2 36453095 missense probably benign 0.00
R0600:Olfr340 UTSW 2 36452648 missense probably benign 0.06
R0881:Olfr340 UTSW 2 36453440 missense probably damaging 1.00
R1945:Olfr340 UTSW 2 36453031 missense probably damaging 1.00
R2184:Olfr340 UTSW 2 36453034 missense probably benign
R2196:Olfr340 UTSW 2 36452588 start codon destroyed probably null 1.00
R2419:Olfr340 UTSW 2 36453326 missense probably damaging 1.00
R2859:Olfr340 UTSW 2 36453130 missense probably benign 0.01
R2964:Olfr340 UTSW 2 36452767 missense probably damaging 1.00
R4677:Olfr340 UTSW 2 36453050 missense probably benign 0.00
R4867:Olfr340 UTSW 2 36453199 missense probably benign
R5468:Olfr340 UTSW 2 36453443 missense probably damaging 0.99
R5582:Olfr340 UTSW 2 36453221 missense probably benign 0.03
R6335:Olfr340 UTSW 2 36452722 missense probably benign 0.22
R6415:Olfr340 UTSW 2 36452605 missense probably damaging 0.99
R6664:Olfr340 UTSW 2 36453098 missense probably benign 0.00
R6873:Olfr340 UTSW 2 36453496 missense probably benign 0.00
R7097:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7122:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7199:Olfr340 UTSW 2 36452860 missense probably damaging 1.00
Z1088:Olfr340 UTSW 2 36452906 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGTCTGAATTCATCCTCTTGGG -3'
(R):5'- AGAAGAACACAGAGGTTCTCAC -3'

Sequencing Primer
(F):5'- AGAGGACCAAGGCCTGTACTC -3'
(R):5'- CAGAGGTTCTCACTCATAATTTGTG -3'
Posted On2019-06-26