Incidental Mutation 'R7275:Retreg1'
ID565537
Institutional Source Beutler Lab
Gene Symbol Retreg1
Ensembl Gene ENSMUSG00000022270
Gene Namereticulophagy regulator 1
Synonyms1810015C04Rik, Fam134b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7275 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location25843180-25973687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25971598 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 208 (D208G)
Ref Sequence ENSEMBL: ENSMUSP00000106068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022881] [ENSMUST00000110438] [ENSMUST00000226438] [ENSMUST00000227275] [ENSMUST00000228306] [ENSMUST00000228327] [ENSMUST00000228600]
Predicted Effect
SMART Domains Protein: ENSMUSP00000022881
Gene: ENSMUSG00000022270
AA Change: D332G

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110438
AA Change: D208G

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106068
Gene: ENSMUSG00000022270
AA Change: D208G

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226438
AA Change: D216G

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000227275
AA Change: D208G

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228306
AA Change: D198G

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228327
Predicted Effect probably benign
Transcript: ENSMUST00000228600
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cis-Golgi transmembrane protein that may be necessary for the long-term survival of nociceptive and autonomic ganglion neurons. Mutations in this gene are a cause of hereditary sensory and autonomic neuropathy type IIB (HSAN IIB), and this gene may also play a role in susceptibility to vascular dementia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thermal nociceptive threshold and sensory neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Gpat2 G C 2: 127,431,367 G224R possibly damaging Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Other mutations in Retreg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Retreg1 APN 15 25966623 unclassified probably null
IGL02548:Retreg1 APN 15 25895118 nonsense probably null
R0834:Retreg1 UTSW 15 25971670 missense probably benign 0.01
R1923:Retreg1 UTSW 15 25969838 missense probably damaging 1.00
R1965:Retreg1 UTSW 15 25970164 missense probably damaging 1.00
R4444:Retreg1 UTSW 15 25968444 unclassified probably null
R4529:Retreg1 UTSW 15 25968514 missense probably damaging 1.00
R4778:Retreg1 UTSW 15 25971785 missense possibly damaging 0.60
R5026:Retreg1 UTSW 15 25970128 missense probably damaging 1.00
R5103:Retreg1 UTSW 15 25968454 nonsense probably null
R6880:Retreg1 UTSW 15 25971739 missense probably damaging 1.00
R7357:Retreg1 UTSW 15 25971943 missense probably damaging 0.97
R7488:Retreg1 UTSW 15 25889542 missense
R7542:Retreg1 UTSW 15 25941210 start codon destroyed probably null 0.10
Predicted Primers PCR Primer
(F):5'- TGGAGAGATACTGCCATCGATTC -3'
(R):5'- TCAAGTGAAGGGCTTGGTCG -3'

Sequencing Primer
(F):5'- CGATTCAGCAGGAGTCTATTACG -3'
(R):5'- TCGCTCTTGAGAGGAAGTGAG -3'
Posted On2019-06-26