Incidental Mutation 'R7282:Taf3'
ID565696
Institutional Source Beutler Lab
Gene Symbol Taf3
Ensembl Gene ENSMUSG00000025782
Gene NameTATA-box binding protein associated factor 3
SynonymsmTAFII140, 4933439M23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7282 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location9914552-10048596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9951442 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 638 (E638G)
Ref Sequence ENSEMBL: ENSMUSP00000026888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026888] [ENSMUST00000114909]
PDB Structure
Solution structure of the free TAF3 PHD domain [SOLUTION NMR]
Solution structure of the TAF3 PHD domain in complex with a H3K4me3 peptide [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000026888
AA Change: E638G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026888
Gene: ENSMUSG00000025782
AA Change: E638G

DomainStartEndE-ValueType
BTP 3 79 1.94e-34 SMART
low complexity region 159 173 N/A INTRINSIC
low complexity region 237 253 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
coiled coil region 519 572 N/A INTRINSIC
coiled coil region 611 651 N/A INTRINSIC
coiled coil region 692 751 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
low complexity region 795 821 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
PHD 869 915 4.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114909
AA Change: E485G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110559
Gene: ENSMUSG00000025782
AA Change: E485G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 334 352 N/A INTRINSIC
coiled coil region 366 419 N/A INTRINSIC
coiled coil region 458 498 N/A INTRINSIC
coiled coil region 539 598 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 642 668 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
PHD 716 762 4.77e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Drg2 A G 11: 60,454,693 E5G probably benign Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Gtf2a1 A T 12: 91,567,835 I215N possibly damaging Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lgsn T G 1: 31,203,371 L178R probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mgam A T 6: 40,656,512 N251Y possibly damaging Het
Mgam A G 6: 40,763,111 T1673A probably benign Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Ovch2 C T 7: 107,794,370 R183H possibly damaging Het
Plxnd1 A T 6: 115,960,837 L1516Q probably damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Unc5c A G 3: 141,677,990 D43G probably damaging Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Taf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Taf3 APN 2 9952917 missense probably damaging 1.00
IGL01620:Taf3 APN 2 9952661 missense probably benign 0.00
IGL02084:Taf3 APN 2 10042519 missense probably benign 0.08
IGL02229:Taf3 APN 2 9952834 missense probably damaging 1.00
IGL02891:Taf3 APN 2 9921227 missense probably damaging 1.00
IGL03173:Taf3 APN 2 9952927 missense probably damaging 0.99
IGL03302:Taf3 APN 2 9952131 missense probably damaging 1.00
Howard UTSW 2 9951160 missense probably damaging 0.99
R0344:Taf3 UTSW 2 9951898 missense probably benign 0.05
R0348:Taf3 UTSW 2 10042644 missense probably benign 0.05
R0506:Taf3 UTSW 2 9940993 missense possibly damaging 0.68
R1724:Taf3 UTSW 2 9952366 missense probably benign 0.01
R2151:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2154:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2495:Taf3 UTSW 2 9952833 missense probably damaging 1.00
R3702:Taf3 UTSW 2 9952561 missense possibly damaging 0.74
R3739:Taf3 UTSW 2 9951658 missense possibly damaging 0.89
R3921:Taf3 UTSW 2 10048298 missense probably benign 0.06
R4097:Taf3 UTSW 2 9952367 missense possibly damaging 0.54
R4602:Taf3 UTSW 2 9952657 missense probably damaging 0.96
R4615:Taf3 UTSW 2 9952090 missense probably damaging 1.00
R4679:Taf3 UTSW 2 10048564 utr 5 prime probably benign
R4789:Taf3 UTSW 2 9951959 missense probably damaging 1.00
R4801:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R4802:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R5201:Taf3 UTSW 2 9952184 missense probably damaging 1.00
R5522:Taf3 UTSW 2 9941005 missense probably damaging 1.00
R5629:Taf3 UTSW 2 9918178 missense probably damaging 1.00
R6427:Taf3 UTSW 2 9951353 missense probably damaging 0.98
R6492:Taf3 UTSW 2 9951160 missense probably damaging 0.99
R6804:Taf3 UTSW 2 9918217 missense possibly damaging 0.91
R7293:Taf3 UTSW 2 9952090 missense probably damaging 0.98
R7368:Taf3 UTSW 2 9916377 missense unknown
Predicted Primers PCR Primer
(F):5'- GACTGTGAAAATGACACCCAGC -3'
(R):5'- TGAAAGACGAAGATTCTGATCCC -3'

Sequencing Primer
(F):5'- GTGAAAATGACACCCAGCTTACCTTC -3'
(R):5'- AGACGAAGATTCTGATCCCTATAAG -3'
Posted On2019-06-26