Incidental Mutation 'R7282:Gtf2a1'
ID565754
Institutional Source Beutler Lab
Gene Symbol Gtf2a1
Ensembl Gene ENSMUSG00000020962
Gene Namegeneral transcription factor II A, 1
SynonymsTfiia1, TfIIAa/b, 19kDa, 37kDa, 6330549H03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7282 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location91555262-91590487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91567835 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 215 (I215N)
Ref Sequence ENSEMBL: ENSMUSP00000021345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021345] [ENSMUST00000063314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021345
AA Change: I215N

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021345
Gene: ENSMUSG00000020962
AA Change: I215N

DomainStartEndE-ValueType
TFIIA 12 378 5.47e-146 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063314
AA Change: I176N

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068562
Gene: ENSMUSG00000020962
AA Change: I176N

DomainStartEndE-ValueType
Pfam:TFIIA 1 339 9.3e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele where D/G cleavage residues are replaced with noncleavable A/A show neonatal lethality, feeding defects, low testis weight, and male infertility associated with azoospermia, small seminiferous tubules, lack of elongating spermatids, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Drg2 A G 11: 60,454,693 E5G probably benign Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lgsn T G 1: 31,203,371 L178R probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mgam A T 6: 40,656,512 N251Y possibly damaging Het
Mgam A G 6: 40,763,111 T1673A probably benign Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Ovch2 C T 7: 107,794,370 R183H possibly damaging Het
Plxnd1 A T 6: 115,960,837 L1516Q probably damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Taf3 T C 2: 9,951,442 E638G probably damaging Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Unc5c A G 3: 141,677,990 D43G probably damaging Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Gtf2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Gtf2a1 APN 12 91567833 missense probably benign 0.00
IGL02561:Gtf2a1 APN 12 91575753 missense possibly damaging 0.93
IGL03035:Gtf2a1 APN 12 91572637 splice site probably benign
PIT4618001:Gtf2a1 UTSW 12 91567769 missense probably benign 0.09
R0436:Gtf2a1 UTSW 12 91568273 splice site probably null
R1595:Gtf2a1 UTSW 12 91589549 missense probably damaging 0.98
R2240:Gtf2a1 UTSW 12 91586739 missense possibly damaging 0.87
R4020:Gtf2a1 UTSW 12 91572577 missense possibly damaging 0.92
R4043:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4044:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4095:Gtf2a1 UTSW 12 91575637 missense possibly damaging 0.68
R4584:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4585:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4952:Gtf2a1 UTSW 12 91575749 missense possibly damaging 0.70
R5465:Gtf2a1 UTSW 12 91567791 missense possibly damaging 0.86
R5566:Gtf2a1 UTSW 12 91567594 missense possibly damaging 0.63
R7055:Gtf2a1 UTSW 12 91586749 missense possibly damaging 0.93
R7220:Gtf2a1 UTSW 12 91567724 missense probably benign 0.00
R7459:Gtf2a1 UTSW 12 91575652 missense probably benign 0.00
R7484:Gtf2a1 UTSW 12 91562973 missense probably benign 0.01
X0063:Gtf2a1 UTSW 12 91572612 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTTCCATCAACTTGCAGCAC -3'
(R):5'- CGCTGCTGGAGTTGTATGAC -3'

Sequencing Primer
(F):5'- TTGCAGCACCAACGGAG -3'
(R):5'- TCCCCCAGACAAGTTAATAGGTGTG -3'
Posted On2019-06-26