Incidental Mutation 'R7283:Prkca'
ID565815
Institutional Source Beutler Lab
Gene Symbol Prkca
Ensembl Gene ENSMUSG00000050965
Gene Nameprotein kinase C, alpha
SynonymsPkca
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R7283 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location107933387-108343928 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 108340645 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059595] [ENSMUST00000059595] [ENSMUST00000133383]
Predicted Effect probably null
Transcript: ENSMUST00000059595
SMART Domains Protein: ENSMUSP00000062392
Gene: ENSMUSG00000050965

DomainStartEndE-ValueType
C1 37 86 3.09e-16 SMART
C1 102 151 1.33e-15 SMART
C2 172 275 7.66e-26 SMART
S_TKc 339 597 8.85e-98 SMART
S_TK_X 598 660 1.58e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000059595
SMART Domains Protein: ENSMUSP00000062392
Gene: ENSMUSG00000050965

DomainStartEndE-ValueType
C1 37 86 3.09e-16 SMART
C1 102 151 1.33e-15 SMART
C2 172 275 7.66e-26 SMART
S_TKc 339 597 8.85e-98 SMART
S_TK_X 598 660 1.58e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133383
SMART Domains Protein: ENSMUSP00000115516
Gene: ENSMUSG00000000049

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 23 51 6.7e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show no overt macroscopic abnormalities, however examination of one line revealed increased cardiac muscle contractility and protection against heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,274,828 Q1346R probably damaging Het
4833439L19Rik A G 13: 54,552,691 V278A probably benign Het
4932415D10Rik G A 10: 82,291,297 R1960W possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abce1 C A 8: 79,685,256 G592* probably null Het
Acad10 A C 5: 121,649,475 V137G possibly damaging Het
Adcy3 A G 12: 4,203,563 I672V not run Het
Adgrb1 A T 15: 74,580,663 Q1166L possibly damaging Het
Ankrd44 A T 1: 54,729,796 N465K probably damaging Het
Avpr1b A G 1: 131,609,731 T418A probably benign Het
Azin1 G A 15: 38,501,408 T33I probably damaging Het
Bicra T C 7: 15,972,500 T1339A probably damaging Het
C2cd4c A G 10: 79,612,572 V247A possibly damaging Het
Cacna1s A G 1: 136,073,708 Y299C probably damaging Het
Clip1 A C 5: 123,613,794 C641W Het
Clip3 T C 7: 30,305,812 S524P probably damaging Het
Cnpy4 A T 5: 138,192,882 H240L probably benign Het
Cyp2b19 T C 7: 26,766,914 Y381H probably damaging Het
Cyp3a13 T A 5: 137,905,556 N280I probably benign Het
Diaph3 A G 14: 86,866,584 F788S probably damaging Het
Drc7 A G 8: 95,071,579 N484S probably damaging Het
Erap1 G A 13: 74,673,784 probably null Het
Fat4 A T 3: 38,889,693 I912F probably damaging Het
Hsd3b3 T A 3: 98,742,357 K217* probably null Het
Igkv12-89 A G 6: 68,835,077 V36A probably damaging Het
Invs T A 4: 48,392,526 probably null Het
Ipo8 T A 6: 148,824,481 Y30F possibly damaging Het
Kctd14 T C 7: 97,451,486 M1T probably null Het
Klrb1c A T 6: 128,784,257 C136S probably benign Het
Morn2 A G 17: 80,297,259 E48G probably damaging Het
Myh1 A T 11: 67,201,844 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,529,050 S603P probably benign Het
Nlrc3 G A 16: 3,947,877 A351V probably benign Het
Nlrp4f G A 13: 65,195,538 R76* probably null Het
Olfr190 A T 16: 59,074,192 M296K probably benign Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr397 T C 11: 73,964,808 S67P probably damaging Het
Olfr664 G T 7: 104,733,593 T257K probably damaging Het
Olfr872 A C 9: 20,260,259 I140L probably damaging Het
Papolg A G 11: 23,867,394 V601A not run Het
Pde4dip T C 3: 97,758,882 T349A probably benign Het
Pdlim5 T C 3: 142,311,980 probably null Het
Pkhd1l1 A G 15: 44,503,280 N718S probably benign Het
Plcxd3 A G 15: 4,516,919 H135R probably damaging Het
Plxna2 A T 1: 194,644,883 Y375F probably damaging Het
Prkdc A G 16: 15,717,764 S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 T80A probably benign Het
Ptpn4 C T 1: 119,682,531 V696I possibly damaging Het
Pygl A T 12: 70,216,568 W175R possibly damaging Het
Rftn1 A G 17: 50,047,441 Y298H probably damaging Het
Rit2 A G 18: 31,316,839 probably null Het
Runx1t1 G A 4: 13,846,935 G240R probably damaging Het
Scn10a A G 9: 119,664,779 probably null Het
Serpina16 A C 12: 103,672,432 probably null Het
Slc17a3 A T 13: 23,855,848 M290L Het
Slc6a4 A T 11: 77,010,696 M86L probably benign Het
Spag7 A T 11: 70,665,313 V46E probably benign Het
Sptlc1 T C 13: 53,344,878 I271V probably benign Het
Stk17b A C 1: 53,757,515 H364Q probably benign Het
Strc T C 2: 121,379,452 H130R probably damaging Het
Stxbp1 T A 2: 32,815,014 D148V probably damaging Het
Tirap G A 9: 35,188,929 P153L probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem51 T A 4: 142,031,783 D218V probably damaging Het
Trim40 A T 17: 36,882,662 D218E probably benign Het
Ttc21b T C 2: 66,208,718 D934G probably damaging Het
Vmn2r26 T C 6: 124,025,955 L108P probably damaging Het
Washc2 C A 6: 116,227,418 P429Q probably damaging Het
Wipi1 A G 11: 109,611,311 M1T probably null Het
Zfp438 A G 18: 5,214,712 V82A probably damaging Het
Zfp853 G C 5: 143,287,738 A724G unknown Het
Other mutations in Prkca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prkca APN 11 108343508 missense probably benign 0.10
IGL00903:Prkca APN 11 107983974 missense probably damaging 1.00
IGL01385:Prkca APN 11 107978352 missense probably damaging 1.00
IGL01396:Prkca APN 11 108014322 missense possibly damaging 0.59
IGL01480:Prkca APN 11 108192201 missense probably damaging 1.00
IGL01480:Prkca APN 11 107986289 missense possibly damaging 0.93
IGL01516:Prkca APN 11 107961602 missense probably null 1.00
IGL01553:Prkca APN 11 108057834 missense probably benign 0.15
IGL02975:Prkca APN 11 108340677 nonsense probably null
IGL03402:Prkca APN 11 108340663 missense probably benign 0.20
R0101:Prkca UTSW 11 108057800 missense probably damaging 1.00
R0279:Prkca UTSW 11 108054111 splice site probably benign
R0454:Prkca UTSW 11 107978280 missense probably benign
R0513:Prkca UTSW 11 108014376 missense possibly damaging 0.82
R0711:Prkca UTSW 11 107981654 missense probably benign 0.16
R0894:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R0966:Prkca UTSW 11 108014284 missense possibly damaging 0.56
R1432:Prkca UTSW 11 107939520 missense probably benign 0.27
R1518:Prkca UTSW 11 107978316 missense probably damaging 1.00
R1667:Prkca UTSW 11 107983946 missense probably damaging 1.00
R1795:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R1909:Prkca UTSW 11 107939612 missense possibly damaging 0.68
R1932:Prkca UTSW 11 108192149 missense probably benign 0.13
R2509:Prkca UTSW 11 107979206 missense probably damaging 1.00
R3889:Prkca UTSW 11 107979240 missense probably damaging 1.00
R4018:Prkca UTSW 11 107939602 missense probably damaging 1.00
R4684:Prkca UTSW 11 107961608 missense probably damaging 0.99
R5132:Prkca UTSW 11 108192117 splice site probably benign
R5298:Prkca UTSW 11 108012684 missense probably damaging 0.98
R5546:Prkca UTSW 11 108053980 missense probably benign 0.14
R5558:Prkca UTSW 11 107981647 missense probably damaging 1.00
R5616:Prkca UTSW 11 107978343 missense possibly damaging 0.85
R5626:Prkca UTSW 11 108057815 missense possibly damaging 0.94
R5931:Prkca UTSW 11 108014310 missense probably benign 0.01
R6061:Prkca UTSW 11 108057845 missense probably benign 0.03
R7125:Prkca UTSW 11 107984022 missense probably damaging 1.00
R7329:Prkca UTSW 11 108014277 missense possibly damaging 0.73
R7510:Prkca UTSW 11 107983994 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGAAGTTCTATGTGCAGATTACTAGGC -3'
(R):5'- ACAGGCTTCTAGTTAAATACTTAGGGG -3'

Sequencing Primer
(F):5'- GTGCAGATTACTAGGCAATACTATGG -3'
(R):5'- CTACAATGTGGTCTCGGT -3'
Posted On2019-06-26