Incidental Mutation 'R7284:Klb'
ID565854
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65383478 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 971 (S971R)
Ref Sequence ENSEMBL: ENSMUSP00000031096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000057885] [ENSMUST00000118543] [ENSMUST00000120094] [ENSMUST00000127874] [ENSMUST00000205084]
Predicted Effect probably benign
Transcript: ENSMUST00000031096
AA Change: S971R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: S971R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057885
SMART Domains Protein: ENSMUSP00000109399
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 8.1e-18 PFAM
Pfam:Ribosomal_L6 99 178 7.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118543
SMART Domains Protein: ENSMUSP00000113391
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.1e-19 PFAM
Pfam:Ribosomal_L6 99 165 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120094
SMART Domains Protein: ENSMUSP00000113704
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 3e-17 PFAM
Pfam:Ribosomal_L6 99 178 2.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127874
SMART Domains Protein: ENSMUSP00000115577
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 80 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150815
Predicted Effect probably benign
Transcript: ENSMUST00000196667
Predicted Effect probably benign
Transcript: ENSMUST00000205084
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 intron probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1372:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R4878:Klb UTSW 5 65348490 missense probably damaging 0.99
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R5841:Klb UTSW 5 65379324 nonsense probably null
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R6955:Klb UTSW 5 65379088 nonsense probably null
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7322:Klb UTSW 5 65383364 missense probably benign 0.44
R7346:Klb UTSW 5 65348631 nonsense probably null
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATATCTCATTGACAAGGTC -3'
(R):5'- AATGGCAGTTTAGCTGAAAACTCTG -3'

Sequencing Primer
(F):5'- GGTCAAAATCAAAGGCTACTATGC -3'
(R):5'- AGCTGAAAACTCTGCTGTGGC -3'
Posted On2019-06-26