Incidental Mutation 'R7285:Usp47'
ID565937
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R7285 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112093108 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 926 (E926K)
Ref Sequence ENSEMBL: ENSMUSP00000147619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably benign
Transcript: ENSMUST00000106653
AA Change: E906K

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: E906K

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210309
AA Change: E926K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215510
AA Change: E926K

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
0152:Usp47 UTSW 7 112056577 missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1447:Usp47 UTSW 7 112074568 critical splice donor site probably null
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2504:Usp47 UTSW 7 112104470 critical splice donor site probably null
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4179:Usp47 UTSW 7 112087884 missense probably damaging 1.00
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4281:Usp47 UTSW 7 112109993 missense probably benign 0.03
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R6271:Usp47 UTSW 7 112087056 missense probably damaging 1.00
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGGAGGTGATTCTGG -3'
(R):5'- AGAGGAATCTGAGCGCTGTC -3'

Sequencing Primer
(F):5'- CCTGCAGGGAATTTAAAGTCTG -3'
(R):5'- GCTGTCTGCATTGCACAAAG -3'
Posted On2019-06-26