Incidental Mutation 'R7286:Whamm'
ID566000
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene NameWAS protein homolog associated with actin, golgi membranes and microtubules
SynonymsWhdc1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7286 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location81571266-81596836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 81586247 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 399 (N399K)
Ref Sequence ENSEMBL: ENSMUSP00000128881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
Predicted Effect probably damaging
Transcript: ENSMUST00000165460
AA Change: N399K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795
AA Change: N399K

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207123
Predicted Effect possibly damaging
Transcript: ENSMUST00000209044
AA Change: N193K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,622,479 C130S probably benign Het
4921501E09Rik T C 17: 33,065,527 D767G probably benign Het
4930550C14Rik A T 9: 53,423,017 M187L possibly damaging Het
9930012K11Rik T C 14: 70,157,237 E156G possibly damaging Het
Acad9 C T 3: 36,075,990 A194V probably damaging Het
Agps T A 2: 75,852,784 V151E probably benign Het
Ak9 A T 10: 41,407,371 I1273L Het
Akr1c19 T A 13: 4,246,819 L288Q probably damaging Het
Carmil1 T G 13: 24,013,394 D1353A probably damaging Het
Ccz1 T A 5: 144,013,079 I43F probably damaging Het
Cep70 G A 9: 99,275,585 C179Y probably damaging Het
Comt A T 16: 18,410,690 L196H probably damaging Het
Cspg5 A T 9: 110,246,955 D253V probably damaging Het
Dars2 A G 1: 161,046,808 V437A possibly damaging Het
Dcaf5 A G 12: 80,348,390 I335T probably damaging Het
Ddn T C 15: 98,806,025 K462R possibly damaging Het
Dscaml1 T C 9: 45,742,746 probably null Het
Ethe1 A G 7: 24,607,952 Y197C probably damaging Het
Evc A T 5: 37,322,183 L269* probably null Het
Fam161a T C 11: 23,020,001 S60P possibly damaging Het
Fam20b A G 1: 156,681,442 V400A probably benign Het
Fam53b T A 7: 132,759,661 S213C possibly damaging Het
Flot2 A G 11: 78,054,786 I45V probably benign Het
Gemin4 A C 11: 76,212,753 L394R probably damaging Het
Glis2 T G 16: 4,611,318 S128R possibly damaging Het
Gm3696 A G 14: 7,089,808 Y92H probably damaging Het
Gm49333 T C 16: 20,632,591 S325P probably benign Het
Gpbp1l1 T C 4: 116,590,245 V374A probably benign Het
Grm1 T C 10: 10,689,696 N956S probably benign Het
Hbb-bh1 T C 7: 103,843,031 E27G probably damaging Het
Hmcn1 A T 1: 150,582,337 C5233S probably damaging Het
Hmgcr C T 13: 96,666,597 C30Y probably damaging Het
Hoxb6 A G 11: 96,292,825 probably benign Het
Igf2 T C 7: 142,655,818 Q35R possibly damaging Het
Ighv1-4 C T 12: 114,487,321 V56I probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lmtk2 C T 5: 144,174,360 Q633* probably null Het
Mesd T C 7: 83,895,749 Y136H probably damaging Het
Mga T A 2: 119,964,788 S2984R possibly damaging Het
Mkrn3 T C 7: 62,418,927 N372S probably benign Het
Mtpap A G 18: 4,387,068 I373V probably benign Het
Mycbp2 G A 14: 103,120,591 T4589M probably damaging Het
Myh2 A G 11: 67,188,369 Q921R probably benign Het
Myom1 A G 17: 71,045,549 D324G possibly damaging Het
Nat10 T C 2: 103,754,169 K88E probably benign Het
Ncapd3 A G 9: 27,069,958 R915G probably damaging Het
Nek4 T C 14: 30,957,292 Y190H probably damaging Het
Nfasc A C 1: 132,602,052 Y797D probably damaging Het
Ngp A G 9: 110,420,910 D92G probably benign Het
Nos2 A C 11: 78,929,854 H95P probably damaging Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1129 C T 2: 87,575,519 T145I probably benign Het
Olfr1350 C A 7: 6,570,716 H242N probably damaging Het
Olfr141 A T 2: 86,806,623 H125Q possibly damaging Het
Olfr498 T C 7: 108,465,435 I37T possibly damaging Het
Otogl T A 10: 107,770,610 D2154V probably benign Het
Pdss1 T A 2: 22,935,641 probably null Het
Pex5 A T 6: 124,398,063 L609* probably null Het
Pglyrp4 C A 3: 90,732,974 A177D probably damaging Het
Phactr4 A G 4: 132,377,178 probably null Het
Pik3cd G C 4: 149,659,714 N193K probably benign Het
Prr36 TACCTCTTC T 8: 4,215,163 probably benign Het
Prss38 A T 11: 59,375,558 W25R probably benign Het
Prss8 T A 7: 127,926,884 Q189L probably damaging Het
Psd T A 19: 46,314,801 D713V probably damaging Het
Rad51ap2 C T 12: 11,457,691 T538I probably benign Het
Rarres1 T C 3: 67,515,184 T78A probably benign Het
Rbl2 G T 8: 91,102,294 G651* probably null Het
Rev3l A T 10: 39,823,605 Q1366L probably damaging Het
Rundc1 T C 11: 101,429,587 S215P probably benign Het
Scarf2 G A 16: 17,802,973 W168* probably null Het
Sh2d7 A G 9: 54,540,902 D69G possibly damaging Het
Slc26a4 A T 12: 31,529,528 Y578* probably null Het
Slc2a9 A T 5: 38,453,195 L87Q probably damaging Het
Slc39a10 A T 1: 46,810,070 H795Q probably damaging Het
Spata13 C T 14: 60,756,422 R1108W probably damaging Het
Sqle T C 15: 59,316,052 S70P probably benign Het
Syncrip A T 9: 88,464,663 F263I probably damaging Het
Synj2 T C 17: 6,037,945 S1424P possibly damaging Het
Tax1bp3 A T 11: 73,181,115 T89S possibly damaging Het
Tcaim G A 9: 122,819,027 probably null Het
Tcp10c T C 17: 13,362,176 I240T possibly damaging Het
Ttll8 G T 15: 88,917,239 N415K probably benign Het
Ugcg T C 4: 59,217,111 S212P possibly damaging Het
Vmn2r32 T C 7: 7,479,808 K56E probably benign Het
Vmn2r55 T C 7: 12,652,073 E660G probably damaging Het
Vmn2r7 T C 3: 64,690,880 N752S probably benign Het
Vps54 T A 11: 21,275,005 M167K probably benign Het
Vwa2 A C 19: 56,909,359 M699L probably benign Het
Wdr59 A G 8: 111,465,862 V689A Het
Zcchc6 T C 13: 59,821,649 E144G probably benign Het
Zfp760 A G 17: 21,722,779 K312E probably benign Het
Zkscan3 C A 13: 21,394,813 V171L probably benign Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81578266 missense probably damaging 1.00
IGL01139:Whamm APN 7 81595914 missense probably damaging 1.00
IGL01870:Whamm APN 7 81595974 missense probably damaging 0.96
IGL03153:Whamm APN 7 81589532 splice site probably benign
R0179:Whamm UTSW 7 81594015 missense probably benign 0.00
R0364:Whamm UTSW 7 81594051 missense probably benign 0.00
R0550:Whamm UTSW 7 81586224 missense possibly damaging 0.55
R0682:Whamm UTSW 7 81586138 missense probably damaging 1.00
R1388:Whamm UTSW 7 81586290 missense probably damaging 1.00
R1940:Whamm UTSW 7 81578299 missense probably null 0.94
R1991:Whamm UTSW 7 81591771 nonsense probably null
R1992:Whamm UTSW 7 81591771 nonsense probably null
R2103:Whamm UTSW 7 81591771 nonsense probably null
R2104:Whamm UTSW 7 81591771 nonsense probably null
R2162:Whamm UTSW 7 81571341 missense probably damaging 1.00
R2291:Whamm UTSW 7 81591771 nonsense probably null
R3078:Whamm UTSW 7 81571784 missense probably damaging 1.00
R4735:Whamm UTSW 7 81571374 missense probably benign 0.01
R6336:Whamm UTSW 7 81591764 missense probably damaging 1.00
R6723:Whamm UTSW 7 81596120 missense probably damaging 1.00
R6747:Whamm UTSW 7 81578302 critical splice donor site probably null
R7029:Whamm UTSW 7 81591826 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGCCAGTATGCTTTGCAG -3'
(R):5'- TAACGGGCATAAGGATTTCTTTGTC -3'

Sequencing Primer
(F):5'- AGCCAGTATGCTTTGCAGTTTTC -3'
(R):5'- GGCATAAGGATTTCTTTGTCTCATG -3'
Posted On2019-06-26