Incidental Mutation 'R7286:Zkscan3'
ID566039
Institutional Source Beutler Lab
Gene Symbol Zkscan3
Ensembl Gene ENSMUSG00000021327
Gene Namezinc finger with KRAB and SCAN domains 3
SynonymsZfp306, 2810435N07Rik, Zfp307, Skz1
Accession Numbers

Genbank: NM_001145778, NM_023685; MGI: 1919989

Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7286 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21387003-21402755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21394813 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 171 (V171L)
Ref Sequence ENSEMBL: ENSMUSP00000068424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070785] [ENSMUST00000116433] [ENSMUST00000116434] [ENSMUST00000117721] [ENSMUST00000223831] [ENSMUST00000224820]
Predicted Effect probably benign
Transcript: ENSMUST00000070785
AA Change: V171L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068424
Gene: ENSMUSG00000021327
AA Change: V171L

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116433
AA Change: V171L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112134
Gene: ENSMUSG00000021327
AA Change: V171L

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116434
AA Change: V171L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112135
Gene: ENSMUSG00000021327
AA Change: V171L

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117721
AA Change: V171L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112862
Gene: ENSMUSG00000021327
AA Change: V171L

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 256 3.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223831
AA Change: V4L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224820
AA Change: V142L

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,622,479 C130S probably benign Het
4921501E09Rik T C 17: 33,065,527 D767G probably benign Het
4930550C14Rik A T 9: 53,423,017 M187L possibly damaging Het
9930012K11Rik T C 14: 70,157,237 E156G possibly damaging Het
Acad9 C T 3: 36,075,990 A194V probably damaging Het
Agps T A 2: 75,852,784 V151E probably benign Het
Ak9 A T 10: 41,407,371 I1273L Het
Akr1c19 T A 13: 4,246,819 L288Q probably damaging Het
Carmil1 T G 13: 24,013,394 D1353A probably damaging Het
Ccz1 T A 5: 144,013,079 I43F probably damaging Het
Cep70 G A 9: 99,275,585 C179Y probably damaging Het
Comt A T 16: 18,410,690 L196H probably damaging Het
Cspg5 A T 9: 110,246,955 D253V probably damaging Het
Dars2 A G 1: 161,046,808 V437A possibly damaging Het
Dcaf5 A G 12: 80,348,390 I335T probably damaging Het
Ddn T C 15: 98,806,025 K462R possibly damaging Het
Dscaml1 T C 9: 45,742,746 probably null Het
Ethe1 A G 7: 24,607,952 Y197C probably damaging Het
Evc A T 5: 37,322,183 L269* probably null Het
Fam161a T C 11: 23,020,001 S60P possibly damaging Het
Fam20b A G 1: 156,681,442 V400A probably benign Het
Fam53b T A 7: 132,759,661 S213C possibly damaging Het
Flot2 A G 11: 78,054,786 I45V probably benign Het
Gemin4 A C 11: 76,212,753 L394R probably damaging Het
Glis2 T G 16: 4,611,318 S128R possibly damaging Het
Gm3696 A G 14: 7,089,808 Y92H probably damaging Het
Gm49333 T C 16: 20,632,591 S325P probably benign Het
Gpbp1l1 T C 4: 116,590,245 V374A probably benign Het
Grm1 T C 10: 10,689,696 N956S probably benign Het
Hbb-bh1 T C 7: 103,843,031 E27G probably damaging Het
Hmcn1 A T 1: 150,582,337 C5233S probably damaging Het
Hmgcr C T 13: 96,666,597 C30Y probably damaging Het
Hoxb6 A G 11: 96,292,825 probably benign Het
Igf2 T C 7: 142,655,818 Q35R possibly damaging Het
Ighv1-4 C T 12: 114,487,321 V56I probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lmtk2 C T 5: 144,174,360 Q633* probably null Het
Mesd T C 7: 83,895,749 Y136H probably damaging Het
Mga T A 2: 119,964,788 S2984R possibly damaging Het
Mkrn3 T C 7: 62,418,927 N372S probably benign Het
Mtpap A G 18: 4,387,068 I373V probably benign Het
Mycbp2 G A 14: 103,120,591 T4589M probably damaging Het
Myh2 A G 11: 67,188,369 Q921R probably benign Het
Myom1 A G 17: 71,045,549 D324G possibly damaging Het
Nat10 T C 2: 103,754,169 K88E probably benign Het
Ncapd3 A G 9: 27,069,958 R915G probably damaging Het
Nek4 T C 14: 30,957,292 Y190H probably damaging Het
Nfasc A C 1: 132,602,052 Y797D probably damaging Het
Ngp A G 9: 110,420,910 D92G probably benign Het
Nos2 A C 11: 78,929,854 H95P probably damaging Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1129 C T 2: 87,575,519 T145I probably benign Het
Olfr1350 C A 7: 6,570,716 H242N probably damaging Het
Olfr141 A T 2: 86,806,623 H125Q possibly damaging Het
Olfr498 T C 7: 108,465,435 I37T possibly damaging Het
Otogl T A 10: 107,770,610 D2154V probably benign Het
Pdss1 T A 2: 22,935,641 probably null Het
Pex5 A T 6: 124,398,063 L609* probably null Het
Pglyrp4 C A 3: 90,732,974 A177D probably damaging Het
Phactr4 A G 4: 132,377,178 probably null Het
Pik3cd G C 4: 149,659,714 N193K probably benign Het
Prr36 TACCTCTTC T 8: 4,215,163 probably benign Het
Prss38 A T 11: 59,375,558 W25R probably benign Het
Prss8 T A 7: 127,926,884 Q189L probably damaging Het
Psd T A 19: 46,314,801 D713V probably damaging Het
Rad51ap2 C T 12: 11,457,691 T538I probably benign Het
Rarres1 T C 3: 67,515,184 T78A probably benign Het
Rbl2 G T 8: 91,102,294 G651* probably null Het
Rev3l A T 10: 39,823,605 Q1366L probably damaging Het
Rundc1 T C 11: 101,429,587 S215P probably benign Het
Scarf2 G A 16: 17,802,973 W168* probably null Het
Sh2d7 A G 9: 54,540,902 D69G possibly damaging Het
Slc26a4 A T 12: 31,529,528 Y578* probably null Het
Slc2a9 A T 5: 38,453,195 L87Q probably damaging Het
Slc39a10 A T 1: 46,810,070 H795Q probably damaging Het
Spata13 C T 14: 60,756,422 R1108W probably damaging Het
Sqle T C 15: 59,316,052 S70P probably benign Het
Syncrip A T 9: 88,464,663 F263I probably damaging Het
Synj2 T C 17: 6,037,945 S1424P possibly damaging Het
Tax1bp3 A T 11: 73,181,115 T89S possibly damaging Het
Tcaim G A 9: 122,819,027 probably null Het
Tcp10c T C 17: 13,362,176 I240T possibly damaging Het
Ttll8 G T 15: 88,917,239 N415K probably benign Het
Ugcg T C 4: 59,217,111 S212P possibly damaging Het
Vmn2r32 T C 7: 7,479,808 K56E probably benign Het
Vmn2r55 T C 7: 12,652,073 E660G probably damaging Het
Vmn2r7 T C 3: 64,690,880 N752S probably benign Het
Vps54 T A 11: 21,275,005 M167K probably benign Het
Vwa2 A C 19: 56,909,359 M699L probably benign Het
Wdr59 A G 8: 111,465,862 V689A Het
Whamm T G 7: 81,586,247 N399K probably damaging Het
Zcchc6 T C 13: 59,821,649 E144G probably benign Het
Zfp760 A G 17: 21,722,779 K312E probably benign Het
Other mutations in Zkscan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Zkscan3 APN 13 21394091 splice site probably benign
IGL02406:Zkscan3 APN 13 21388178 missense possibly damaging 0.71
IGL02725:Zkscan3 APN 13 21394893 missense possibly damaging 0.85
IGL02741:Zkscan3 APN 13 21393994 missense probably benign 0.05
3-1:Zkscan3 UTSW 13 21387881 missense probably benign 0.32
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0133:Zkscan3 UTSW 13 21394774 missense possibly damaging 0.73
R0660:Zkscan3 UTSW 13 21388460 missense probably damaging 1.00
R0737:Zkscan3 UTSW 13 21388596 missense probably benign
R1250:Zkscan3 UTSW 13 21388524 missense probably benign 0.32
R1671:Zkscan3 UTSW 13 21396135 missense possibly damaging 0.93
R1926:Zkscan3 UTSW 13 21396446 missense possibly damaging 0.88
R2899:Zkscan3 UTSW 13 21393973 missense probably damaging 1.00
R4119:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4120:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4606:Zkscan3 UTSW 13 21393783 missense probably benign 0.00
R5459:Zkscan3 UTSW 13 21394812 missense probably damaging 0.96
R5549:Zkscan3 UTSW 13 21394063 missense probably damaging 1.00
R5631:Zkscan3 UTSW 13 21394533 missense probably damaging 1.00
R5988:Zkscan3 UTSW 13 21396291 missense probably damaging 1.00
R6495:Zkscan3 UTSW 13 21387905 missense probably damaging 0.97
R7363:Zkscan3 UTSW 13 21387822 missense probably damaging 0.99
Z1088:Zkscan3 UTSW 13 21388565 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGCCTAGTAGCTGTCACTCCATC -3'
(R):5'- TGCCAAGCTGATAGGAAATGTC -3'

Sequencing Primer
(F):5'- GTGAGACTCACTCTAGCATCAG -3'
(R):5'- CCAAGCTGATAGGAAATGTCTTTGG -3'
Posted On2019-06-26