Incidental Mutation 'R7286:Mtpap'
ID566061
Institutional Source Beutler Lab
Gene Symbol Mtpap
Ensembl Gene ENSMUSG00000024234
Gene Namemitochondrial poly(A) polymerase
SynonymsPapd1, 0610027A18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7286 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location4375592-4397330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4387068 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 373 (I373V)
Ref Sequence ENSEMBL: ENSMUSP00000025077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025077]
Predicted Effect probably benign
Transcript: ENSMUST00000025077
AA Change: I373V

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025077
Gene: ENSMUSG00000024234
AA Change: I373V

DomainStartEndE-ValueType
PDB:3PQ1|B 44 528 N/A PDB
SCOP:d1f5aa2 187 523 1e-35 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DNA polymerase type-B-like family. This enzyme synthesizes the 3' poly(A) tail of mitochondrial transcripts and plays a role in replication-dependent histone mRNA degradation.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,622,479 C130S probably benign Het
4921501E09Rik T C 17: 33,065,527 D767G probably benign Het
4930550C14Rik A T 9: 53,423,017 M187L possibly damaging Het
9930012K11Rik T C 14: 70,157,237 E156G possibly damaging Het
Acad9 C T 3: 36,075,990 A194V probably damaging Het
Agps T A 2: 75,852,784 V151E probably benign Het
Ak9 A T 10: 41,407,371 I1273L Het
Akr1c19 T A 13: 4,246,819 L288Q probably damaging Het
Carmil1 T G 13: 24,013,394 D1353A probably damaging Het
Ccz1 T A 5: 144,013,079 I43F probably damaging Het
Cep70 G A 9: 99,275,585 C179Y probably damaging Het
Comt A T 16: 18,410,690 L196H probably damaging Het
Cspg5 A T 9: 110,246,955 D253V probably damaging Het
Dars2 A G 1: 161,046,808 V437A possibly damaging Het
Dcaf5 A G 12: 80,348,390 I335T probably damaging Het
Ddn T C 15: 98,806,025 K462R possibly damaging Het
Dscaml1 T C 9: 45,742,746 probably null Het
Ethe1 A G 7: 24,607,952 Y197C probably damaging Het
Evc A T 5: 37,322,183 L269* probably null Het
Fam161a T C 11: 23,020,001 S60P possibly damaging Het
Fam20b A G 1: 156,681,442 V400A probably benign Het
Fam53b T A 7: 132,759,661 S213C possibly damaging Het
Flot2 A G 11: 78,054,786 I45V probably benign Het
Gemin4 A C 11: 76,212,753 L394R probably damaging Het
Glis2 T G 16: 4,611,318 S128R possibly damaging Het
Gm3696 A G 14: 7,089,808 Y92H probably damaging Het
Gm49333 T C 16: 20,632,591 S325P probably benign Het
Gpbp1l1 T C 4: 116,590,245 V374A probably benign Het
Grm1 T C 10: 10,689,696 N956S probably benign Het
Hbb-bh1 T C 7: 103,843,031 E27G probably damaging Het
Hmcn1 A T 1: 150,582,337 C5233S probably damaging Het
Hmgcr C T 13: 96,666,597 C30Y probably damaging Het
Hoxb6 A G 11: 96,292,825 probably benign Het
Igf2 T C 7: 142,655,818 Q35R possibly damaging Het
Ighv1-4 C T 12: 114,487,321 V56I probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lmtk2 C T 5: 144,174,360 Q633* probably null Het
Mesd T C 7: 83,895,749 Y136H probably damaging Het
Mga T A 2: 119,964,788 S2984R possibly damaging Het
Mkrn3 T C 7: 62,418,927 N372S probably benign Het
Mycbp2 G A 14: 103,120,591 T4589M probably damaging Het
Myh2 A G 11: 67,188,369 Q921R probably benign Het
Myom1 A G 17: 71,045,549 D324G possibly damaging Het
Nat10 T C 2: 103,754,169 K88E probably benign Het
Ncapd3 A G 9: 27,069,958 R915G probably damaging Het
Nek4 T C 14: 30,957,292 Y190H probably damaging Het
Nfasc A C 1: 132,602,052 Y797D probably damaging Het
Ngp A G 9: 110,420,910 D92G probably benign Het
Nos2 A C 11: 78,929,854 H95P probably damaging Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1129 C T 2: 87,575,519 T145I probably benign Het
Olfr1350 C A 7: 6,570,716 H242N probably damaging Het
Olfr141 A T 2: 86,806,623 H125Q possibly damaging Het
Olfr498 T C 7: 108,465,435 I37T possibly damaging Het
Otogl T A 10: 107,770,610 D2154V probably benign Het
Pdss1 T A 2: 22,935,641 probably null Het
Pex5 A T 6: 124,398,063 L609* probably null Het
Pglyrp4 C A 3: 90,732,974 A177D probably damaging Het
Phactr4 A G 4: 132,377,178 probably null Het
Pik3cd G C 4: 149,659,714 N193K probably benign Het
Prr36 TACCTCTTC T 8: 4,215,163 probably benign Het
Prss38 A T 11: 59,375,558 W25R probably benign Het
Prss8 T A 7: 127,926,884 Q189L probably damaging Het
Psd T A 19: 46,314,801 D713V probably damaging Het
Rad51ap2 C T 12: 11,457,691 T538I probably benign Het
Rarres1 T C 3: 67,515,184 T78A probably benign Het
Rbl2 G T 8: 91,102,294 G651* probably null Het
Rev3l A T 10: 39,823,605 Q1366L probably damaging Het
Rundc1 T C 11: 101,429,587 S215P probably benign Het
Scarf2 G A 16: 17,802,973 W168* probably null Het
Sh2d7 A G 9: 54,540,902 D69G possibly damaging Het
Slc26a4 A T 12: 31,529,528 Y578* probably null Het
Slc2a9 A T 5: 38,453,195 L87Q probably damaging Het
Slc39a10 A T 1: 46,810,070 H795Q probably damaging Het
Spata13 C T 14: 60,756,422 R1108W probably damaging Het
Sqle T C 15: 59,316,052 S70P probably benign Het
Syncrip A T 9: 88,464,663 F263I probably damaging Het
Synj2 T C 17: 6,037,945 S1424P possibly damaging Het
Tax1bp3 A T 11: 73,181,115 T89S possibly damaging Het
Tcaim G A 9: 122,819,027 probably null Het
Tcp10c T C 17: 13,362,176 I240T possibly damaging Het
Ttll8 G T 15: 88,917,239 N415K probably benign Het
Ugcg T C 4: 59,217,111 S212P possibly damaging Het
Vmn2r32 T C 7: 7,479,808 K56E probably benign Het
Vmn2r55 T C 7: 12,652,073 E660G probably damaging Het
Vmn2r7 T C 3: 64,690,880 N752S probably benign Het
Vps54 T A 11: 21,275,005 M167K probably benign Het
Vwa2 A C 19: 56,909,359 M699L probably benign Het
Wdr59 A G 8: 111,465,862 V689A Het
Whamm T G 7: 81,586,247 N399K probably damaging Het
Zcchc6 T C 13: 59,821,649 E144G probably benign Het
Zfp760 A G 17: 21,722,779 K312E probably benign Het
Zkscan3 C A 13: 21,394,813 V171L probably benign Het
Other mutations in Mtpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Mtpap APN 18 4379670 missense probably damaging 0.99
IGL00848:Mtpap APN 18 4380717 missense probably benign 0.00
IGL02659:Mtpap APN 18 4380703 nonsense probably null
IGL02828:Mtpap APN 18 4386207 missense probably damaging 0.99
IGL03006:Mtpap APN 18 4375721 missense possibly damaging 0.49
R0031:Mtpap UTSW 18 4383244 missense probably damaging 0.96
R0350:Mtpap UTSW 18 4396195 missense possibly damaging 0.91
R3787:Mtpap UTSW 18 4380670 missense probably damaging 1.00
R4381:Mtpap UTSW 18 4383223 missense probably benign 0.04
R4698:Mtpap UTSW 18 4375724 missense possibly damaging 0.59
R4717:Mtpap UTSW 18 4396394 missense possibly damaging 0.82
R4850:Mtpap UTSW 18 4387044 missense probably damaging 1.00
R4963:Mtpap UTSW 18 4375638 missense probably benign 0.05
R4982:Mtpap UTSW 18 4396332 missense probably benign 0.01
R5059:Mtpap UTSW 18 4375827 intron probably benign
R5311:Mtpap UTSW 18 4386328 missense probably damaging 1.00
R5600:Mtpap UTSW 18 4379674 missense probably damaging 1.00
R5713:Mtpap UTSW 18 4396280 missense probably benign 0.00
R6312:Mtpap UTSW 18 4396175 missense possibly damaging 0.89
R7006:Mtpap UTSW 18 4380873 missense possibly damaging 0.63
R7059:Mtpap UTSW 18 4396202 missense probably damaging 1.00
R7117:Mtpap UTSW 18 4380889 critical splice donor site probably null
X0025:Mtpap UTSW 18 4375710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTGTGTCTTAACTTGGG -3'
(R):5'- CACAGCACTTACAATTTGGAATCAG -3'

Sequencing Primer
(F):5'- CTTAACTTGGGGTTTGCAGTTC -3'
(R):5'- CTGCTATGGACTTTAGGGAA -3'
Posted On2019-06-26