Incidental Mutation 'R7287:Lrriq1'
ID566110
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7287 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103216016 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 292 (Y292N)
Ref Sequence ENSEMBL: ENSMUSP00000020043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect probably benign
Transcript: ENSMUST00000020043
AA Change: Y292N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: Y292N

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
AA Change: Y292N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: Y292N

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: Y292N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: Y292N

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,883 R1059H possibly damaging Het
Abca3 A G 17: 24,385,887 D656G possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc8 T C 7: 46,113,110 H1209R probably damaging Het
Adam26a T C 8: 43,570,343 T37A possibly damaging Het
Adamts9 C T 6: 92,890,003 R685Q possibly damaging Het
Anapc7 T A 5: 122,433,436 N191K probably benign Het
Ankrd26 C T 6: 118,549,637 probably null Het
Ap5z1 T C 5: 142,474,047 L484P probably damaging Het
Arhgap32 A G 9: 32,152,697 D77G Het
Atp10a T A 7: 58,827,269 D1213E probably damaging Het
B3gnt8 T C 7: 25,628,970 L275P probably damaging Het
Cab39 A G 1: 85,818,461 E21G probably benign Het
Capn15 G T 17: 25,960,455 S948R probably damaging Het
Cbarp T C 10: 80,137,320 T15A unknown Het
Ccdc81 C T 7: 89,893,123 A182T probably damaging Het
Ccpg1 A G 9: 73,015,406 H766R probably benign Het
Cfl1 T C 19: 5,492,534 V14A probably benign Het
Chd6 A G 2: 161,008,392 I875T probably benign Het
Cidec T A 6: 113,428,398 E121D probably benign Het
Clpx C A 9: 65,300,013 Y64* probably null Het
Cyp24a1 A G 2: 170,485,906 L472P probably damaging Het
Dcdc2c G T 12: 28,516,686 D159E probably benign Het
Emp1 T C 6: 135,380,169 F82L probably benign Het
Fem1b T C 9: 62,796,122 T619A probably benign Het
Fgf15 A T 7: 144,896,794 D39V probably benign Het
Galnt12 T G 4: 47,108,525 F221V probably damaging Het
Hspg2 G A 4: 137,529,556 V1537I probably benign Het
Insr G A 8: 3,169,717 T935I probably benign Het
Itgax G A 7: 128,148,505 C1031Y probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kmt5b T C 19: 3,804,501 Y255H possibly damaging Het
Mrpl37 A G 4: 107,060,520 F318S probably damaging Het
Nav2 A G 7: 49,420,328 N311D probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp9b T C 7: 20,028,456 C673R probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Plce1 A T 19: 38,701,903 Q677L probably benign Het
Pmel C T 10: 128,715,226 Q113* probably null Het
Pom121l2 T A 13: 21,984,332 F924L probably benign Het
Poteg G A 8: 27,453,344 R214K probably null Het
Pprc1 G T 19: 46,071,354 S1480I unknown Het
Secisbp2l A G 2: 125,740,369 S1056P probably benign Het
Selenoo T C 15: 89,098,700 F477L probably benign Het
Senp2 A G 16: 22,018,364 D121G probably damaging Het
Slc25a11 T C 11: 70,645,355 D211G probably benign Het
Slc44a2 A G 9: 21,342,456 D131G probably benign Het
Tcf25 G A 8: 123,373,972 A34T possibly damaging Het
Tm9sf3 A G 19: 41,217,379 Y530H probably damaging Het
Tmem132d G T 5: 127,984,351 Q396K probably damaging Het
Tmem154 A G 3: 84,690,563 T136A possibly damaging Het
Tnrc6b A G 15: 80,879,541 T415A possibly damaging Het
Ttyh1 T C 7: 4,125,658 Y185H probably benign Het
Ufl1 T A 4: 25,254,852 T535S probably benign Het
Vmn1r15 T C 6: 57,258,216 L23P possibly damaging Het
Vmn2r25 T A 6: 123,852,081 H78L possibly damaging Het
Vmn2r68 T C 7: 85,222,252 T608A probably benign Het
Vwf A G 6: 125,637,467 I1104V Het
Zbtb2 C T 10: 4,368,986 D347N possibly damaging Het
Zfyve9 A T 4: 108,718,256 S543T probably benign Het
Zhx1 T C 15: 58,053,296 N518S probably damaging Het
Zmym6 T C 4: 127,122,982 V852A possibly damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGTAATGATCAGTGGCG -3'
(R):5'- GCACTTTCACCCGTCATTTAGG -3'

Sequencing Primer
(F):5'- AGTGGGCATGTTCCCTCAGTC -3'
(R):5'- CTGATGCTCATAACTATGTCTG -3'
Posted On2019-06-26